Labshake search
Citations for Addgene :
1351 - 1400 of 2504 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Neuroscience 2021Quote: Mice were injected with inhibitory DREADDs pAAV8-hSyn-DIO-hM4DimCherry (Titer: 2.9×1013 GC/mL, Vol: 100μL, Lot: v54499; Addgene) in IN ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5; http://n2t.net/addgene:111068; RRID:Addgene_111068).
-
bioRxiv - Neuroscience 2019Quote: ... we co-injected a total volume of 4μL of 1Χ1013 vg/mL of AAV9-CAG-flex-GCaMP6s (Addgene) and AAV9-syn-jRCaMP1b (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... 120 to 150 nl of AAV1.hSynap.SF-iGluSnFR.A184S.WPRE.SV40 (HHMI Janelia Research Campus and Addgene, titer 2.7e13 GC/ml) were pressure-injected at a depth of approximately 350 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
Basolateral amygdala parvalbumin neurons report aversive prediction error to constrain fear learningbioRxiv - Neuroscience 2020Quote: ... AAV5-ef1α-DIO-eNpHR3.0-eYFP (1.1×1013 GC/ml) (pAAV-Ef1a-DIO eNpHR 3.0-EYFP was a gift from Karl Deisseroth (Addgene viral prep # 26966-AAV5 ...
-
bioRxiv - Neuroscience 2021Quote: ... (a gift from Loren Looger, Addgene plasmid # 98929; http://n2t.net/addgene:98929; RRID:Addgene_98929; 1013 vg/mL in water) was injected into the vitreous humour of wild type mice (C57BL/6J ...
-
bioRxiv - Neuroscience 2022Quote: pAAV-CAG-tdTomato (titer ≥ 1×10¹³ vg/mL) was a gift from Edward Boyden (Addgene viral prep #59462-AAV9; http://n2t.net/addgene:59462; RRID:Addgene_59462). A volume of 0.20 µl of pAAV-CAG-tdTomato was injected into the PVT (L= 0.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1, viral titer ≥ 5×1012 vg/mL; Addgene, Watertown, MA, USA), pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 animals received rejections of AAV5-CaMKIIa-hM4Di-mCherry (titer 9.5×10^12 GC/ml; Addgene, MA, USA), while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... heterozygous D2-Cre mice were bilaterally injected with 400 nl of AAV5-CAG-FLEX-ArchT3.0-tdTomato (1.3×1013 GC/ml, Addgene) or AAV5-EF1a-DIO-eYFP (1.3×1013 GC/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... was injected into ALM (AP 2.90, ML 1.55, DV .75mm) and/or AAV1-syn-NES-jRGECO1a-WPRE-SV40 (500nL, Addgene) was injected into CS (AP .50 ...
-
bioRxiv - Neuroscience 2022Quote: ... 15° angle) and 0.5 μl of AAV5-hSyn-DIO-hM4D(Gi)-mCherry (2.4 × 10^13 GC/ml; Addgene) 26 or AAV5-hSyn-DIO-mCherry (2.3 × 10^13 GC/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... animals were injected with 250 nl of AAV5-hSyn-hM4Di-mCherry (Addgene, viral titer 2.8 × 1013 vg/mL) in the NAcSh (stereotaxic coordinates from Bregma ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Neuroscience 2022Quote: ... Pups were injected bilaterally with 4 ul of AAV9-hSyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene). Mice also received an injection of AAV9-hSyn-GRABACh3.0 to express the genetically encoded cholinergic sensor GRABACh3.0 48 ...
-
bioRxiv - Neuroscience 2022Quote: ... Retrograde tracing was performed using the viral vectors AAV2retro-CAG-FLEX-tdTomato (1.3E13 GC/ml) obtained from Addgene (provided by Edward Boyden ...
-
bioRxiv - Neuroscience 2022Quote: ... the viral vector pAAV-CamKII-ArchT-GFP (titer: 1.9×1013 genome copies per ml, Addgene, Watertown, MA, USA) was injected bilaterally 0.45 mm from the midline at 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent AAV encoding GCaMP6s (AAV9 CAG-FLEx-GCaMPs-WPRE-SV40, 1.5 × 1013 gp/ml; Addgene, #100842-AAV9) was injected into the ARC using the following coordinates from the bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... virus or a AAV5-EF1a-DIO-hChR2(H134R)-eYFP (4.2×1012 vg/mL, UNC GTC Vector core, USA, RRID:Addgene_35507) control virus were injected with the same protocol as above to infect the entire mesencephalon of Syt1+/+ and Syt1-/- mice ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following adeno-associated viruses (AAVs): AAV5-hSyn-mCherry (2.3 x 1013 vg/mL, Addgene #114472), AAV5-hSyn-hM4D(Gi)-mCherry (8.6 x 1012 vg/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... For in vivo imaging: Two 300 nl injections of AAV2retro-pkg-Cre (Addgene 24593, 1.4 × 1013 GC/ml) and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... 300nL of AAV/DJ-hSyn1-DIO-tdTomato-T2A-Syp::eGFP-WPRE (2.5 × 1013 GC/mL from Addgene #51509) was injected unilaterally at a rate of 60nL/sec ...
-
bioRxiv - Neuroscience 2023Quote: ... while L5 ET were specifically targeted by injecting 300nl of rAAV2retro-Cre (AddGene #55636-AAVrg, 2.1013 vg/ml) in the Pons ...
-
bioRxiv - Neuroscience 2023Quote: ... a volume of 800 nL of AAV5-CAG-dLight1.3b-GFP (titer 1.03 x 1013 viral particles/ mL; Addgene) was infused per site at a rate of 100 nL/ min through a 31-G ...
-
bioRxiv - Neuroscience 2023Quote: ... Either AAV2/8-hSYN-JAWS-tdTomato-ER2 (Neurophotonics, diluted 2.5x from 9.8e2 GC/ml stock into PBS) or AAV8-hSyn-mCherry (Addgene catalog #114472 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-pEF1a-DIO-FLPo-WPRE-hGHpA (2x1012 gc/ml) was a gift from Li Zhang (Addgene plasmid # 87306) (Zingg et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM3D(Gq)-mCherry (1.83x1012 gc/ml) was a gift from Bryan Roth (Addgene plasmid # 44361) (Krashes et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAVretro-Cre (pAAV-Ef1a-mCherry-IRES-Cre, 55632-AAVrg, 1.1-3.5 x 1012 viral genomes/ml, Addgene) into the ipsilateral posterior medial nucleus of the thalamus (POM) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Neuroscience 2024Quote: ... University of Pennsylvania vector core) and AAV1-Syn-Flex-GCaMP6f-WPRE-SV40 (0.4 μl, 1.3 x 1013 GC/ml, Addgene) was injected into the IL ...
-
bioRxiv - Neuroscience 2024Quote: ... we intracranially injected 350 nL of AAVrg-hSyn-EGFP (Addgene 50465-AAVrg; titer: 2.4 x 1012 vg/mL) into the right NAcSh at coordinates AP ...
-
bioRxiv - Neuroscience 2024Quote: ... we intracranially injected 350 nL of AAVrg-hSyn-mCherry (Addgene 114472-AAVrg; titer: 2.4 x 1012 vg/mL) at coordinates AP ...