Labshake search
Citations for Addgene :
1301 - 1350 of 2504 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... LV-Cre pLKO.1 (Addgene plasmid 25997), which encodes Cre-recombinase in the backbone of the pLKO.1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-shGFP control (Addgene, cat#30323); pLKO.1-shATR (TCRN0000039615 ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Immunology 2024Quote: ... psPAX2 (1 µg; Addgene plasmid no. 12260) and pTRIP-SFFV-CD271-P2A-ACE2 (1.6 µg ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G (1 µg, Addgene, 12259), plus the pscALPS-hACE2 or -cACE2 (1 µg ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μg packaging plasmid (Addgene #12260). 24 hours post transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... we injected the viral vector AAV5-hSyn-hM4Di-mCherry (titer = 4.9 × 1012 genome copies/mL, RRID: Addgene_50475) at locations informed by the mapping experiments (Fig ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.1 μL of pAAV.hSyn.GFP viruses (AAV1, gift from Bryan Roth, Addgene #50465, titration 7.1012 vg/mL), or with 0.1 μL of the later diluted in 4 μl PBS for the control group ...
-
bioRxiv - Neuroscience 2021Quote: ... was loaded with the GCaMP6s virus (AAV9.Syn1.GCaMP6s.WPRE.SV40, ≈1.9x1013 GC/ml, Penn Vector Core; RRID: Addgene_100843) and was slowly lowered into VTA (DV -8.1 mm relative to brain surface) ...
-
bioRxiv - Neuroscience 2022Quote: ... consisting of AAV1-Syn1(S)-FLEX-tdTomato-T2A-SypEGFP (1.8 × 1013 GC/ml, 133 nl, Addgene #51509) and AAV9.CaMKII 0.4.Cre (2.1 × 1013 GC/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... into IL (bregma +0.175 AP, +/-0.03 ML, -0.03 DV) or injected with pAAV.hSyn.eGFP.WPRE.bGH (Addgene Cat. No. 105539-AAV9) into IL as controls ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Neuroscience 2020Quote: ... A cohort of SOM.iPKR and PKCδ.iPKR mice were injected with bilaterally in CeL with 200 nl of AAV.Eef1a1 Pr.DIO.EGFPL10a (7 × 10^^12 GC/ml, Addgene) for immunohistochemistry experiment; ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Neuroscience 2021Quote: ... and contralaterally in VP with a matched AAV2 DIO-mCherry control vector (4.7 × 1012 GC/mL, AddGene). Three weeks later ...
-
bioRxiv - Molecular Biology 2021Quote: ... 700ng/mL of proteinA-micrococcal nuclease (pA-Mnase purified in house with vector from Addgene 86973 79) were incubated with the nuclei at 4 degrees for an hour ...
-
bioRxiv - Neuroscience 2022Quote: Rbp4-cre mice were bilaterally injected with AAV5-hSyn-hM4D(Gi)-mCherry (1.2 × 10e13 GC/ml, Addgene) into POm (AP -2.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... pENN-AAV1-hSyn-Cre-WPRE (titer: 1.8×10e13 GC/ml, Addgene 105553, gift from James M. Wilson) was injected into the piriform cortex or medial prefrontal cortex ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1α-DIO-hM3Dq-mCherry (2.4×1012 vg/ml, Addgene plasmid #50460-AAV5; http://www.addgene.org/50460/; RRID: Addgene_50460), pAAV-EF1α-DIO-mCherry (3.6×1012 vg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... in the same pipette a combination of AAV2-pCAG-FLEX-eGFP- WPRE (2.5E12 GC/mL, Addgene 51502) and flp-dependent mCherry (2E13 GC/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... or rAAV5-hsyn-DIO-mCherry (around 5.0 x 1012 vg/ml for each) (Addgene, Watertown, MA, USA) in the dorsal raphe nucleus [Anterior-posterior (AP) ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1α-DIO-mCherry (3.6×1012 vg/ml, Addgene plasmid #50462-AAV5; http://www.addgene.org/50462/; RRID: Addgene_50462), pAAV-EF1a-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50460 ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 150-250 nL of AAV5-EF1α-DIO-hChR2(H134R)-mCherry (5.25 x 1012 GC/ml, RRID:Addgene_20297), AAV5-EF1α-DIO-mCherry (7.3 x 1012 GC/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... for optogenetic control: Two 400 nl injection of AAV2retro-GAG-ChR2 (Addgene 28017, 7 × 1012 VG/ml) or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (titer: 2.3 × 1013 GC/ml; prepared by Addgene, MA, USA) into the unilateral dorsal hippocampus as described previously 87.
-
bioRxiv - Neuroscience 2023Quote: ... A control vector lacking the hM4Di receptor was also used (AAV8-CaMKII-EGFP; 2.1 x 1013 gc/ml Addgene viral prep # 50469-AAV8; http://n2t.net/addgene:50469; RRID:Addgene_50469 ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-dLight1.1 a gift from Lin Tian (titer 1.3 × 1012 genome copies per ml; Addgene viral prep # 111067-AAV1; http://n2t.net/addgene:111067; RRID:Addgene_111067) or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Cre-dependent control plasmid pAAV-hSyn-DIO-mCherry (AddGene #50459-AAV8; titer of 2.2×1013 GC/mL), or the retrogradely transported Cre-expressing plasmid pENN-rAAV-hSyn-HI-eGFP-Cre-WPRE-SV40 #105540-AAVrg ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV vector encoding for inhibitory DREADD (AAV5-SYN1-hM4Di-HA 1.7*1013 GC/ml (Addgene, Watertown MA)) was injected into the bilateral basolateral amygdala stereotaxically ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson, 1.20e+13 gc/mL, 250 nL, Addgene #62723-AAV5), AAVrg-hSyn-Cre-WPRE-hGH (retro-Cre ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...