Labshake search
Citations for Addgene :
1251 - 1300 of 2504 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... RLAs received AAV5-hSyn-DOI-hM4D(Gi)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44362). As a control ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-hSyn-Cre-WPRE-hGH (retro-Cre, 2.10e+13 gc/mL, 80 nL, Addgene #105553-AAVrg), AAV1-Syn-Chronos-GFP (Chronos ...
-
bioRxiv - Genomics 2019Quote: ... pENTR4-GST 6P-1 (w487-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17741) (22) ...
-
bioRxiv - Neuroscience 2020Quote: ... Animals were infused bilaterally with 1 μl of AAV5-hSyn-DIO-hM4Di-mCherry (1012 particles.ml−1, Addgene, Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA sequences targeting LINE-1 ORF169 were cloned into pLKO.1-TRC cloning vector (Addgene, cat# 10878) using EcoR1 and AgeI restriction enzyme digestion ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Molecular Biology 2021Quote: ... sgRNA against exon 23 (Table 2) was cloned downstream of the U6 promoter of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene plasmid # 48138) 61 ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The S1R-Apex and GFP-Apex plasmids were co-transfected into either HeLa cells (ATCC; CCL-2) or HEK293T cells (ATCC; CRL-3216) along with pXAT2 (Addgene plasmid 80494) (30) ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were transformed by standard lithium acetate methods to fluorescently labelled indicated organelles with monomeric Kusibara Orange 2 (mKO2) obtained from Addgene (Cambridge, MA). Peroxisomes in strains engineered with deletions of DNM1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Templates used to create the PCR fragments were pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (gift from Nevan Krogan; Addgene plasmid #141382), pCEP4-myc-ACE2 (gift from Erik Procko ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Microbiology 2023Quote: The ISRE-Luc reporter plasmid (32) (25 ng) was either transfected alone or co-transfected with a plasmid expressing SARS-CoV-2 genes NSP13 (Addgene, cat. 141379) (25 ng) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: The following AAV vectors were used for channelrhodopsin-2 expression: pAAV-EF1a-double floxed-hChR2 (H134R)-EYFP-WPRE-HGHpA (Addgene plasmid #20298), pAAV-EF1a-double floxed-hChR2 (H134R)-mCherry-WPRE-HGHpA (Addgene plasmid #20297) ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... a pan-neuronal AAV expressing EGFP (rAAV2/1.hSynapsin.EGFP.WPRE.bGH, Penn Vector Core, AV-1-PV1696, Addgene ID 105539) was used for stereotaxic injections into wildtype C57BL/6J mice ...
-
bioRxiv - Neuroscience 2020Quote: ... we used a Cre-dependent AAV vector that robustly expresses EGFP within the cytoplasm of Cre-expressing infected neurons (AAV2/1.pCAG.FLEX.EGFP.WPRE.bGH, Penn Vector Core, AV-1-ALL854, Addgene ID 51502).
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434; w785-1: Addgene plasmid #26730 ...
-
bioRxiv - Neuroscience 2019Quote: ... a pan-neuronal AAV expressing EGFP (rAAV2/1.hSynapsin.EGFP.WPRE.bGH, Penn Vector Core, AV-1-PV1696, Addgene ID 105539) was used for injections into wildtype C57BL/6J mice at postnatal day 56 (stock no ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scramble shRNA pLKO.1 vector (Addgene, 1864) was used as a control.
-
bioRxiv - Cell Biology 2020Quote: ... h-lin-28 and EBNA-1 (Addgene plasmids #27077 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 μg of psPAX2 (Addgene #12260), and with 21 μL of TransIT-Lenti (Mirus #6603) ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1.hSyn.ChR2(H134R)-eYFP.WPRE.hGH (Addgene 26973P) was injected in the pulvinar in the left hemisphere ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg pMD2.G (envelope plasmid; Addgene), and 3 μg psPAX2 (packaging plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLKO.1 puro GFP siRNA (Addgene, # 12273)43 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg gag/pol (psPAX2, Addgene, 12260), and 0.25 μg VSV-G (pMD2.G ...
-
bioRxiv - Biochemistry 2021Quote: ... pCMV6-XL4 ASXL1 (1-1304) (Addgene # 74244); pCMV6-XL4 ASXL1 (p.Y591X ...
-
bioRxiv - Microbiology 2021Quote: ... pet41s GST ATF6αTAD (aa 1-150) (Addgene) contained the TAD domain.
-
bioRxiv - Cell Biology 2022Quote: ... kif5b(1-560)-EGFP-6His (AddGene #15219), and Sfp-6His (AddGene #75015 ...
-
bioRxiv - Neuroscience 2023Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and KIF5C(1-560)-mCit (Addgene #61676) were a gift from Kristen Verhey92 ...