Labshake search
Citations for Addgene :
1301 - 1350 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6×1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pCOLA-Gent-EM7-Erv1p-PDI were both cloned with 2 fragment gibson assemblies (Addgene Cat#202486). For each assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... and pICH51288 and pICH41414 (2×35S and 35S terminator; Addgene #50269 and #50337; Engler et al., 2014) in a BsaI Golden Gate reaction to generate binary vectors containing the fragment-swapped Rcr3/Pip1 hybrids driven by the double 35S CaMV promoter and targeted to the apoplast using a NtPR1a signal peptide ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids for his-FUSLC (residue 1 to 163) and LAF-1 RGG (residue 1 to 168) were acquired from Addgene (https://www.addgene.org/127192/ (Fawzi laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964). AAV2/9 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the helper pAAV2/5 (Addgene #104964), pAAV2/8 (Addgene #112864) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg pCL-Eco (#12371, Addgene) in Opti-MEM with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... 5 µg of psPax2 (Addgene, Cat# 12260), and 2 µg of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg envelope plasmid pMD2.G (Addgene), and 20 µg transfer plasmid (pTRIPZ ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (for AAV5; Addgene plasmid # 104964), or pAAV2/9n (for AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2019Quote: ... CaVα2δ-1 (Addgene, 26575), and enhanced green fluorescent protein cDNAs (eGFP ...