Labshake search
Citations for Addgene :
1451 - 1500 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Neuroscience 2022Quote: ... excitatory Gq-coupled DREADDs (hSyn-hM3Dq-mCherry-AAV1/2 viral stocks, 4.0 × 1011 GC/mL titer, plasmid #50474 from Addgene), and control construct (hSyn-enhanced green fluorescent protein (EGFP)-AAV2 1:10 dilution of viral stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... into the DR and bilateral infusions of AAVretro-hSyn-DIO-EGFP (200 nL over 2 min; 1.3 x 1013 GC/mL, Addgene) into the BLA ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #1 (TRCN0000281950, Addgene #136584), shNRF2 #2 (TRCN0000284998 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #1 (TRCN0000416347, Addgene #136581), shJUND #2 (TRCN0000416920 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg psPAX2 (Addgene, 12260), 2 µg lentiviral plasmids and 10 µl dH2O was further added with 150 µl serum free DMEM and 9 µl X-tremeGENE HP DNA Transfection Reagent (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.shNkx2-1 (Addgene Plasmid #32400) or pLKO.shScramble (Addgene Plasmid #1864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 Lentiviral constructs (Addgene) were transfected into 293FT cells using 35μg polyethylenimine per transfection (Alfa Aesar) ...
-
bioRxiv - Cell Biology 2020Quote: pLKO.1 puro (Addgene #8453) was modified to carry:
-
bioRxiv - Neuroscience 2022Quote: pLKO.1-TRC (Addgene, 10878) vector was used for the knockdown of YTHDF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-neo (Addgene, 13425) was used as the backbone ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pISH-Gucy2d-1 (Addgene, #105459), pISH-V1rb1 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.syn.jGCaMP7s 50 (Addgene, 104487-AAV1 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420 ...
-
bioRxiv - Cell Biology 2022Quote: ... pMA122 (peel-1, Addgene #34873), and co-injection markers were injected into N2 young adult worms ...
-
bioRxiv - Cell Biology 2023Quote: ... pLKO.1-Scrambled (Addgene #136035)9 was modified to express H2B-mRuby3 for visual identification of transduced cells based on a nuclear fluorescence signal10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The pLKO.1 (Addgene #8453) lentiviral vector was digested with AgeI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-110 (Addgene #213500), α-syn 96-140 (Addgene #213501) ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-95 (Addgene #213499), α-syn 1-110 (Addgene #213500) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PLKO.1 (Plasmid #8453, Addgene) backbone was used ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The pRPC-oscillator plasmid is based on pZS1-lTlrLLtCL [3] (Addgene #26489) with the dCas9 gene taken from pdCas9-bacteria [18] (Addgene #44249) ...
-
bioRxiv - Immunology 2021Quote: ... EMTP-3×GFP was a gift from William Bement (Addgene plasmid # 26741). Histone 2B-GFP was a gift from Geoff Wahl (Addgene plasmid # 11680) ...