Labshake search
Citations for Addgene :
1151 - 1200 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Neuroscience 2021Quote: ... DJ-1 (pGEX-5X-1-DJ1-WT; Addgene) or pcDNA plus RFP plasmid(57 ...
-
bioRxiv - Neuroscience 2023Quote: ... titer ≥ 1×1013 vg/mL) and pAAV-CAG-GFP (titer ≥ 7×1012 vg/mL) viral preps were purchased from Addgene (Addegene viral prep # ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50 ng/µl Peft-3::Cas9 (Addgene 46168) and 2,5 ng/µl Pmyo-2::tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746 ...
-
bioRxiv - Cell Biology 2023Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab). To generate Emerald-Rab7L8A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Bioengineering 2020Quote: ... pCXLE-hMLN and pCXLE-hOCT3/4 that were a gift from Shinya Yamanaka (Addgene plasmid # 27078, 27079 and 27076), according to previously reported papers(80,81) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) were transfected into HEK-293 T cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446; http://n2t.net/addgene:17446; RRID: Addgene_17446). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138) containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...