Labshake search
Citations for Addgene :
1251 - 1300 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Plant Biology 2023Quote: ... These Level 0 promoter parts were used in in one-step digestion-ligation reactions with the Level 1 Loop pCk1 (Addgene #136695) backbones together with parts containing LucN (pEPYC0CM0133 ...
-
bioRxiv - Neuroscience 2021Quote: ... a 1:1 mixture of AAV9-hSyn-Cre (1:40000 dilution, Addgene: 105553-AAV9, titer: 3.3×1013vg/ml) and AAV1-Syn-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1, Addgene), CAV-2 Cre (Titer ≥ 2.5×1011 pp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-160 and 1-220 were cloned in pEBG-GST (Addgene). The vector expressing eGFP was described previously (49) ...
-
bioRxiv - Neuroscience 2024Quote: ... were injected a 1:1 mixture of pAAV.Syn.GCaMP6f.WPRE.SV40 (Addgene, stock #100837) virus and pAAV.CAG.LSL.tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The patient-specific iPSCs were generated from LCLs by transfection with a combination of episomal plasmids (pCE-hOCT3/4, pCE-hSK, pCE-hUL, and pCE-mp53DD) (Addgene Inc.), as previously reported (Barrett et al ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Biochemistry 2022Quote: ... All plasmids generated by this study have been deposited to Addgene for distribution (See Supplemental Table 4 for Addgene accession numbers).
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2019Quote: ... and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY, gift from Tim Foster, Addgene plasmid # 68939) (Lee et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Retrovirus expressing NFAT1-GFP was constructed by inserting BglII/HpaI NFAT1-GFP fragment from HA-NFAT1(4-460)-GFP plasmid (Addgene #11107) into BglII/HpaI sites of pMSCV-Blasticidin plasmid (addgene #75085 ...
-
bioRxiv - Cancer Biology 2023Quote: ... they were transduced with lentivirus containing pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep #17446-LV)] at a multiplicity of infection of 10 for 48 hours before washing with PBS and replacing with fresh medium ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...