Labshake search
Citations for Addgene :
801 - 850 of 908 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... pLV-mRuby3-MLC-IRES-Neo was created by PCR-amplifying MLC (MYL9) and mRuby3 using pLV-Ftractin-mRuby3-p2A-mTurquoise-MLC-IRES-Blast as templates (Addgene 85146) and by inserting the products into BamHI/NotI-digested pLV-EF1a-IRES-Neo31 (Addgene 85139 ...
-
bioRxiv - Cell Biology 2024Quote: ... Scarlet-tagged constructs were created by Gibson assembly of inserts generated by PCR from βII-spectrin SR1-17:mGreenLantern and αII-spectrin SR8-10:mGreenLantern inserted into pCCL-mScarlet (Addgene, #209889).
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-GfaABC1D-tagBFP-miR30 plasmid was generated by combining the tagBFP sequence with the miR30 sequence (Horizon, pGIPZ plasmid) using overlapping PCR and subcloned into pAAV-GfaABC1D-eGFP plasmid (Addgene #176861). The pAAV-GfaABC1D-tagBFP-miR30-scramble and pAAV-GfaABC1D-tagBFP-miR30-shAckr3 constructs were subcloned into the pAAV-GfaABC1D-tagBFP-miR30 vector with the following target sequences.
-
bioRxiv - Biochemistry 2024Quote: ... FLAG-tagged TDP43 WT or mutant coding DNA sequence (CDS) was PCR amplified and cloned into a doxycycline-inducible pCW vector (Addgene #50661) at NheI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The GFP- shPten-shPhgdh and GFP-shPten-shRen fragments were then PCR amplified and InFusion cloned into EcoRI-linearized cEF1a-LSL-GFP (Addgene #135672) which was modified to replace the EF1α promoter with a CMV promoter by InFusion cloning ...
-
bioRxiv - Immunology 2024Quote: ... each RBD variant was tagged with a unique 26-nucleotide (N26) barcode via PCR and assembled into Yeast surface display vector (Addgene, 166782). The XBB.1.5 and JN.1 DMS libraries were further transfected into electrocompetent DH10B cells for plasmid amplification and proceed to PacBio sequencing library preparation to decipher the association between RBD variant and corresponding N26 barcode ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCEBZ-Flag-GST-PLAT expressing various N-terminally Flag-tagged proteases were generated by PCR amplification of the respective sequences from the plasmids pDONR223-furin (Addgene #82122), p-hCathepsin L (Addgene #11250) ...
-
bioRxiv - Neuroscience 2024Quote: ... was made by replacing coding sequences from the rabies oG protein with orthologous sequences from N2cG (PCR amplified from Addgene #73481). High scoring predicted splice donor and splice acceptor sites on the N2cG sense sequence were mitigated by introduction of synonymous codon substitutions to enhance protein expression.26 pAAV-ehSyn-fDIO-TVA950-eYFP ...
-
bioRxiv - Cell Biology 2024Quote: ... pLVX-EF1a-H2B-emiRFP703-neo was created by PCR of H2B-emiRFP703 from pH2B-emiRP703 (a gift from Vladislav Verkhusha, AddGene #136567) with primers 5’-ATGCCAGAGCCAGCGAAG-3’ and 5’-TTAGCTCTCAA-GCGCGGTGATC-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: pLEX-FLAG-Cre-GFP was generated by cloning PCR-amplified N-terminal FLAG tagged Cre-GFP (from pCAG-Cre-GFP; Addgene #13776) (Forward primer ...
-
bioRxiv - Cancer Biology 2024Quote: The TWEAK overexpression construct was generated by amplifying the soluble TWEAK (sTWEAK) sequence from cDNA through PCR and this was cloned into pLJM1-EGFP (Addgene; 19319), replacing EGFP ...
-
bioRxiv - Genetics 2024Quote: ... We generated SiT-ddCas12a-[Repr] by introducing the DNase-inactivating E993A by PCR-based mutagenesis using SiT-Cas12a-[Repr] (Addgene #133568) as template ...
-
bioRxiv - Neuroscience 2024Quote: ... DsecattP40-flip-out-3xP3-DsRed was generated by PCR amplification of pJFRC208-10XUAS-FRT>STOP>FRT-myr::smGFP-HA53 (Addgene #63166) and integration into Dsec-attP40-3xP3-DsRed.
-
bioRxiv - Molecular Biology 2024Quote: ... pL2M-CMV-MPH-P2A-Puro was cut using NheI-HF and BamHI-HF and the resulting vector backbone was used for Gibson Assembly with gBlock 5169 (see above) and a fragment containing p300Core-HA tag that was PCR amplified from pcDNA-dCas9-p300 (Addgene # 61357) using primers 5372/5373 ...
-
bioRxiv - Biochemistry 2024Quote: ... genes were PCR-amplified with the primers listed in Table S1 using the following templates: RFK: pDONR223-RFK (Addgene plasmid #23698) [16] ...
-
bioRxiv - Developmental Biology 2024Quote: ... Nucleotide fragments of EGFP and hPDGFRB(512-561) were PCR-amplified from pHR-EGFPligand (a generous gift from Wendell A. Lim, Addgene #79129). Nucleotide fragments for PCR-amplification of LaM4 ...
-
bioRxiv - Genomics 2024Quote: ... The cassette containing the CmR and ccdB genes was amplified by PCR from the pSTARR-seq_fly-hsp70 plasmid (Addgene #71500, (18)) ...
-
bioRxiv - Cell Biology 2024Quote: ... a FLAG-RPB1-N792D-ΔCTD fragment was PCR amplified (Forward primer: 5’ – CAATTCCACAACACTTTTGTCTTATACTTGGATCCATGGACTACAAGGACGACGATGACA - 3’; Reverse primer: 5’ – TAGGGGGGGGGGAGGGAGAGGGGCCGGCCGGGGCTCAGCTGGGAGACATGGCACCAC – 3’) from FLAG-Pol2-WT (Addgene, 35175) (55 ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid # 19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid #19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was digested with XbaI and cloned into the XbaI site of the pTrex-n-eGFP plasmid (ADDGENE: #62544). LpBBS1 ...
-
bioRxiv - Cell Biology 2024Quote: The sgRNAs were made by in vitro transcription for which the DNA templates were prepared by PCRs on plasmid pPUR-hU6-sgRNA-Sirius-8XMS2 (Addgene #121942) as the template encoding the optimized tracr RNA sequence with the integrated MS2 stem loops50 ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Cell Biology 2020Quote: ... primary miRNAs for miR-29a and miR-16 were amplified from genomic DNA by PCR and cloned into the pAdTrack shuttle (Addgene, Plasmid#16404). The miR-16 pAdTrack plasmid was then mutated by site-directed mutagenesis to induce 3 point mutations into the miR-16 seed sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tol2-mCherry was produced by digesting Tol2-EGFP-C1 with NheI/EcoRI to remove GFP and inserting mCherry amplified by PCR from 8xGliBS-IVS2-mCherry-NLS-polyA-Tol2 (a gift from James Chen (Addgene plasmid #84604), Mich et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Cancer Biology 2022Quote: A Piggybac version of the FUCCI reporter (BII-ChPtW-iresFUCCI) was constructed by PCR amplification of the Clover-Geminin-ires-mKO2-Cdt fragment from pLL3.7 (Addgene Plasmid #83841, [33]) and insertion into unique BsmBI sites within the Piggybac vector BII-ChPtW ...
-
bioRxiv - Molecular Biology 2020Quote: dCas9 repressor was PCR-amplified with primers containing SfiI sites from dCas9-KRAB-MeCP2 (a gift from Alejandro Chavez & George Church; Addgene plasmid #110821) (Yeo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... a fragment encoding the residues 1382-1690 was cloned by PCR as a XhoI-NotI fragment from the pFRT/TO/FLAG/HA-DEST TNRC6C vector (Addgene plasmid 19885) (52 ...
-
bioRxiv - Immunology 2021Quote: ... GFP-YVAD was PCR-amplified from pEGFP-C3 and cloned into the Lamp1-RFP plasmid (a gift from Walter Mothes; RRID: Addgene Cat.#1817) (Sherer et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... double-stranded DNA sequences complementary to the target sequences were generated by PCR and then cloned into the pSpCas9(BB)-2A-GFP (PX458) vector (AddGene, cat. # 48138) (Table S1) ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplified PCR product was digested with NheI and EcoRI enzymes and inserted into linearized pLJM1 plasmid (gift from David Sabatini, Addgene, plasmid# 19319). Whole plasmid sequencing was performed to confirm that the DN-FYN sequence was correct ...
-
bioRxiv - Cell Biology 2021Quote: The same techniques were used to add fluorescent protein tags at the chromosomal loci of genes of interest using PCR fragments amplified from plasmids: pFA6a-GFP(S65ST)-KanMX6 and pFA6a-GFPEnvy-KanMX6 (Addgene, Watertown MA). Selection for positive transformants was carried out as described above and confirmed by visual analysis using wide-field fluorescence microscopy.
-
bioRxiv - Cell Biology 2021Quote: ... pLBR08 was generated via Gibson assembly of PCR-amplified LAMP1 cDNA (from mTagRFP-T-Lysosomes-20 acquired from Nikon Imaging Center at UCSF, Addgene plasmid #58022) and PCR-amplified XTEN80-mEGFP-3xHA immunoprecipitation tag with a linearized backbone generated from ClaI and BspDI (New England BioLabs cat ...
-
bioRxiv - Cell Biology 2021Quote: ... Amplified fragments were fused C- or N-terminally to Cry2olig (as indicated in the text and figures) using overlap-extension PCR and subcloned into NheI/BstBI cloning sites of pLJM1 (Addgene plasmid 19319) for constitutive expression or EcoRI site of pLVX (TaKaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... and then the entire expression cassette was PCR amplified and cloned into the PacI and BglII sites of the plasmid HO-hisG-URA3-hisG-poly-HO (Addgene plasmid #51661). The integrating inducible yeast expression vectors for N-terminally FLAG-tagged human JNK1 (isoform α1 ...
-
bioRxiv - Biophysics 2021Quote: ... a bacterial expression plasmid pBADGCaMP6s was first created by PCR amplification of the GCaMP6s gene from pGP-CMV-GCaMP6s (Addgene Plasmid #40753), followed by a Gibson Assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... mutation that converts threonine 154 into alanine) were PCR-amplified from pTRE-TIGHT-Cx43-eYFP (gifted from Robin Shaw; Addgene Plasmid #31807) and cloned into the pcDNA3.1-HA (gifted from Oskar Laur ...
-
bioRxiv - Neuroscience 2022Quote: ... Yap1 and Yap1-5SA with attB sites were amplified PCR (polymerase chain reaction) from pQCXIH-Myc-Yap1(5SA) (a kind gift from Kunliang Guan, Addgene plasmid # 33093) and pcDNA3-Yap1 (a kind gift from Stefano Piccolo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Both optogenetic receptors were assembled through an initial generation of a vector backbone through PCR amplification of opto-mFGFR (a gift from Harald Janovjak, Addgene plasmid #58745) to omit the mFGFR coding region ...
-
bioRxiv - Immunology 2022Quote: ... pTRIPZ-puro-HA-Ub was generated by Gibson assembly by PCR amplification of HA-tagged ubiquitin gene from the plasmid HA-Ubiquitin which was a gift from Edward Yeh (Addgene plasmid # 18712) and pTRIPZ-puro digested with AgeI and XhoI ...
-
bioRxiv - Cell Biology 2020Quote: ... the SV40 terminator sequence was PCR-amplified from plasmid pSBtet-GP (pSBtet-GP was a gift from Eric Kowarz, Addgene plasmid # 60495) (Kowarz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... coli Top10 by blunt-end ligation of a fragment generated with a PCR with Jwu267 and Jwu184 and psgRNA29 plasmid as a template (psgRNA was a gift from David Bikard; Addgene plasmid # 114005), gRNA sequence is ACTGGCTAATGCACCCAGTA.
-
bioRxiv - Microbiology 2021Quote: ... The fusion PCR product was ligated using the NotI and AscI restriction sites into an expression plasmid obtained from Addgene (plasmid # 114561) in frame with the mouse constant IgG2a heavy chain46 ...
-
bioRxiv - Systems Biology 2021Quote: ... The 12xMBS-PBS sequence was PCR-amplified from plasmid Pcr4-12xMBS-PBS (Wu et al., 2014) (gift from Robert Singer; Addgene plasmid #52984) and cloned after the stop codon of the reporter gene sequence ...
-
bioRxiv - Systems Biology 2021Quote: ... The iRFP670 coding sequence was PCR-amplified from plasmid pNLS-iRFP670 (Shcherbakova and Verkhusha, 2013) (gift from Vladislav Verkhusha (Addgene plasmid #45466) with a primer containing the CAAX motif and cloned in place of the firefly luciferase gene into plasmid pDN100 (Niopek et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: Plasmids encoding primate CEACAM1 N-domains were constructed by assembly PCR and ligation independent cloning (LIC) into the pcDNA3 GFP LIC vector (6D) (a gift from Scott Gradia; Addgene plasmid #30127). A detailed description of the assembly PCRs is provided in the Supplementary file 7 and the DNA oligomers and templates are described in Supplementary files 8 and 9 ...
-
bioRxiv - Biochemistry 2021Quote: ... Templates used to create the PCR fragments were pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (gift from Nevan Krogan; Addgene plasmid #141382), pCEP4-myc-ACE2 (gift from Erik Procko ...
-
Sunday driver mediates multi-compartment Golgi outposts defects induced by amyloid precursor proteinbioRxiv - Neuroscience 2021Quote: ... and EGFP cDNA were amplified by PCR and transferred into the vector pJFRC2-10×UAS-IVS-mCD8-GFP (plasmid #: 26214, Addgene, Cambridge, MA). The construct was then injected into embryos of PBac{y[+]-attP-3B}VK00033 to generate transgenic flies ...
-
bioRxiv - Evolutionary Biology 2021Quote: Significant results from the MPRA assay of interest were amplified by PCR and cloned into the pLS-mP-Luc vector (Addgene Cat# 106253) in place of GFP ...