Labshake search
Citations for Addgene :
751 - 800 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... 293T cells were transiently co-transfected with the expression vector carrying either the GFP (pLVDest-GFP) or the GFP-MCIDAS gene (pLVDest-GFP-McIdas) and the two helper plasmids psPAX2 (packaging vector, Addgene 12260) and pMD2.G (envelope vector ...
-
bioRxiv - Genetics 2023Quote: ... and assembled as a c-terminal FRB fusion gene and replacing the spCas9-mSA cassette of the PCS2+ Cas9-mSA plasmid (Addgene 103882) (Gu et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... pET22b-6h-GST-TEVp was digested with BamHI and XhoI restriction enzymes in order to remove TEVp gene (Addgene plasmid #172887). α-synuclein was cloned into pET22b-6h-GST backbone by Gibson assembly method ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmid pNH33 was generated by connecting two genes with a SL2 trans-splicing sequence and inserted into pCFJ910 (a gift from Erik Jorgensen, Addgene #44481) with the pie-1p and pie-1 3’UTR ...
-
bioRxiv - Microbiology 2022Quote: Individual sgRNAs (2 per gene) from the Brie library or designed using Benchling (S3 Table) were cloned into lentiGuide-Puro (Addgene #52963), lentiCRISPR v2-blast (Addgene #98293) ...
-
bioRxiv - Plant Biology 2023Quote: ... Guide RNA targeting a unique region of OsCLSY3 gene at 1st exon (UCCUCUCGGCCCUCCAACAG) was cloned into pRGEB32 vector (Addgene Plasmid #63142) (Xie and Yang ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting a common exon of splicing variants of each gene of interest were cloned into BBsI-linearised pSpCas9(BB)-2A-GFP vector (Addgene #48138) using NEBuilder® HiFi DNA Assembly (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... a Neomycin resistance gene and a negative selection marker expressing tagBFP and was derived from pDONOR-tagBFP-PSM-EGFP (Addgene 100603). Flanking the positive selection cassette ...
-
bioRxiv - Neuroscience 2023Quote: ... was made by cloning the TRE-tight element from pAAV-TREtight-mTagBFP2-B19G (Liu et al., 2017) and the EGFP gene into pB-CAG-TEVp-IRES-mCherry (Addgene 174377) in place of the CAG-TEVp-IRES-mCherry sequences using HiFi seamless cloning (NEB).
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Bioengineering 2022Quote: The mCherry double-stranded gene insert was procured from Integrated DNA Technologies (Coralville, USA) and assembled into the pTlpA39-Wasabi vector (Addgene #86116)[46] using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV capsid AAV1-X1 was built by inserting a 7-mer peptide between AAs 588-589 of the AAV1 cap gene in AAV1-Rep-Cap (Challis et al. 2019) (Addgene 112862).
-
bioRxiv - Cancer Biology 2022Quote: ... A MYC T58A gene (synthesized by IDT, Coralville, USA, using the human MYC T58A sequence as template from Addgene plasmid # 18773) [69] ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR guides were designed to flank the coding sequence of the targeted gene and cloned into the Lenti- Cas9-gRNA-GFP vector (Addgene #124770) as described above ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR guides were designed to flank the coding sequence of the targeted olfactory gene and cloned into the Lenti-Cas9-gRNA-GFP vector (Addgene #124770) as described above ...
-
bioRxiv - Cell Biology 2023Quote: ... organoids were electroporated with CRISPR-concatamer vectors containing gene-specific guide RNAs (gRNAs) in combination with a Cas9 expression plasmid (Addgene #41815), at a 1:1 ratio ...
-
bioRxiv - Biophysics 2023Quote: ... The gene fragment was excised using BstXI and XhoI restriction enzymes and then subcloned into similarly digested pmNeonGreen-DEVD-NLuc (Addgene: 98287)65 plasmid DNA ...
-
bioRxiv - Microbiology 2023Quote: Plasmids expressing HA-tagged Rab9a CA or DN variants were constructed as follows: CA and DN mutant Rab9a genes were amplified from JB84 (Addgene #128908) and DsRed-rab9 DN (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... The all-in-one HER2 CAR constructs used for in vivo tumor control studies were cloned by digesting an empty lentiviral vector for constitutive gene expression (Addgene 79121) with MluI and amplifying the HER2-CAR70 and 2A-GFP or 2A-BATF3 (gblock ...
-
bioRxiv - Cell Biology 2023Quote: pKLV-U6gRNA(BbsI)-PGKblast2ABFP vector was generated by replacing the puromycin resistant gene in pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene plasmid #50946) with blasticidin via Gibson assembly.
-
bioRxiv - Cancer Biology 2023Quote: ... mice were generated by subcloning an N-terminal 3x HA-tagged CIC-DUX4 fusion gene from Yoshimoto et al.6 into a Rosa26 targeting construct (Addgene #21714). The sequence verified construct was then transfected into ES cells and selected in G418 media ...
-
bioRxiv - Biochemistry 2023Quote: ... HEK293T cells were transfected with pSIN vector coding for either NanoLucCTZ or NanoLuc gene together with 2nd generation of lentiviral production plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and mito-PDCD10-mScarlet-I (mito-PDCD10) constructs were created by inserting a custom gene block (IDT) in the pMTS-mScarlet-I-N1 plasmid (Addgene 85059) using the XhoI/EcoRI sites ...
-
bioRxiv - Biochemistry 2023Quote: ... reporter plasmids were generated by replacing the IRES sequence between Renilla and Firefly luciferase genes in pCDNA3 RLUC POLIRES FLUC (Addgene #45642) with appropriate 15-codon linkers.
-
bioRxiv - Molecular Biology 2023Quote: An sgRNA targeting the ZFC3H1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Microbiology 2024Quote: ... Lentiviruses carrying the target genes were generated by co-transfecting lentiviral transfer plasmid (pLVX-EF1a-Puro) with packaging plasmids pMD2G (Addgene, 12259) and psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: Silencing constructs for DevPF2 and DevPF1 were generated by cloning genomic gene fragments into a T444T plasmid (Sturm et al., 2018) (Addgene, USA) using CPEC (Quan & Tian ...
-
bioRxiv - Genomics 2024Quote: ... and the top two scoring sgRNAs for each target gene based on depletion or enrichment phenotypes were cloned into dual sgRNA lentivirus expression vectors with direct capture tags (Addgene 187241)40 using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs #E2621L ...
-
bioRxiv - Biochemistry 2024Quote: ... The genes were cloned into pHis17 vector (obtained from Löwe lab, MRC LMB, Cambridge; refer Addgene plasmid #78201 for vector backbone) using restriction-free cloning (van den Ent and Löwe ...
-
bioRxiv - Immunology 2023Quote: DNA comprised of the human HDAC2 gene with flanking BglII and BamHI restriction sites was synthesized and cloned into pmVenus (L68V)-mTurquoise2 (AddGene #60493) such that a fusion protein of mVenus-HDAC2-mTurqoise2 was produced ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNA oligos targeting the C-terminal region of target genes were cloned into the pX330 Cas9/sgRNA expression plasmid (Addgene 42230). For generation of the reporter line ...
-
bioRxiv - Microbiology 2024Quote: ... The new product replaced an existing gene when inserted into pcDNA3.1 containing a triple N-FLAG-tag between KpnI and EcoRI (Addgene plasmid #67788). The GFP transfection control plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... The Msn2 and Msn4-GFP expression plasmids were made by inserting the coding sequence of the genes in between the PDC1 promoter and GFP in the pCU-PDC1-GFP vector (Zordan et al. 2013) (AddGene #45342). The ScDAL80-GFP reporter was constructed by amplifying the 1kb upstream region of ScDAL80 and placing it in front of a yeGFP in a pRS426 (ATCC #77107 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Synthetic Biology 2021Quote: ... obtained as double stranded gene fragments and cloned into pBAD24 (pBAD24-sfGFPx1 was a gift from Sankar Adhya & Francisco Malagon, Addgene plasmid #51558) (41 ...
-
bioRxiv - Plant Biology 2021Quote: ... The reporter gene construct pUbiGUSPlus was a gift from Claudia Vickers (Addgene plasmid # 64402; http://n2t.net/addgene:64402; RRID:Addgene_64402, Vickers et al., 2003). Additionally to overexpression or RNAi silencing constructs ...
-
bioRxiv - Cell Biology 2021Quote: ... The correct clone was used as entry clone and then the cloned gene was shuttled to destination vector pLX301 (Addgene Plasmid #25895) For constitutive overexpression of either Alkbh5 or Alkbh5-HA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single guide RNA (sgRNA) sequences against genes of interest were cloned into lentiviral targeting plasmid pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene plasmid # 60955). Optimal target sequences were selected from62 ...
-
bioRxiv - Neuroscience 2019Quote: ... These were cloned in parallel into the 3’UTR of the luciferase gene in the pIS-0 vector (12178, Addgene, Cambridge, MA) [27] and DNA extracted and purified ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... cerevisiae HO gene with its endogenous promoter and the CloNAT resistance cassette (pHS3 was a gift from John McCusker, Addgene plasmid # 81038). Transformants were selected on fresh selection medium (YPD ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Bioengineering 2021Quote: RNA Mango control and EXO-Probe gene fragments were synthesized (IDT) and cloned into the shRNA-expressing plasmid vector pSLQ1615 (Addgene, Watertown, MA). Plasmids were transformed into E ...
-
bioRxiv - Neuroscience 2021Quote: ... solution carrying the jGCaMP7s gene under the human synapsin promoter (AAV1-hsyn-jGCaMP7s, ~1e12 GC/ml, 50 nl in each injection spot, Addgene plasmid #104487) was injected into the visual ...
-
bioRxiv - Cell Biology 2021Quote: The same techniques were used to add fluorescent protein tags at the chromosomal loci of genes of interest using PCR fragments amplified from plasmids: pFA6a-GFP(S65ST)-KanMX6 and pFA6a-GFPEnvy-KanMX6 (Addgene, Watertown MA). Selection for positive transformants was carried out as described above and confirmed by visual analysis using wide-field fluorescence microscopy.
-
bioRxiv - Biophysics 2021Quote: ... a bacterial expression plasmid pBADGCaMP6s was first created by PCR amplification of the GCaMP6s gene from pGP-CMV-GCaMP6s (Addgene Plasmid #40753), followed by a Gibson Assembly (New England Biolabs ...