Labshake search
Citations for Addgene :
801 - 850 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... BY4741 cells and mutant strains from the BY4741 gene knockout library were made prototrophic by transformation with the pHLUM plasmid (Addgene, Watertown, Massachusetts) [40] ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... a whole- genome library of exon-targeting sgRNAs (10 sgRNA per gene; Morgens et al., 2017) was synthesized and cloned into a lentivirus vector (Addgene, Cat# 89359) which together with third- generation lentiviral packaging plasmids (pVSVG ...
-
bioRxiv - Molecular Biology 2022Quote: AAV2/9 vectors were generated by Atlantic Gene Therapies (University of Nantes, Institut de Recherche Thérapeutique, Nantes, France) using pX600 (SaCas9-AAV) (Addgene, Watertown, MA, USA) and pAAVio-2x.sgRNA (Dmd dual sgRNA-AAV).
-
bioRxiv - Molecular Biology 2021Quote: The AAV_Actb HR donor plasmid used for the Cas9-stimulated HR gene targeting assay was a gift from Hui Yang (Addgene plasmid #97317) and consisted of 800bp homology arms targeting the β-actin locus with the P2A-mCherry sequence between the homology arms ...
-
bioRxiv - Microbiology 2022Quote: Lentivirus containing the MCMV m164 gene was produced by co-transfection of pLV-m164-FLAG with psPAX2 (a gift from Didier Trono, Addgene plasmid #12260) and pCMV-VSV-G (a gift from Bob Weinberg ...
-
bioRxiv - Immunology 2022Quote: ... pTRIPZ-puro-HA-Ub was generated by Gibson assembly by PCR amplification of HA-tagged ubiquitin gene from the plasmid HA-Ubiquitin which was a gift from Edward Yeh (Addgene plasmid # 18712) and pTRIPZ-puro digested with AgeI and XhoI ...
-
bioRxiv - Cell Biology 2022Quote: ... Multiple guide RNAs targeting a gene were cloned into the Lenti-multi-Guide plasmid (a gift from Qin Yan; Addgene plasmid #85401) and delivered to iCas9-expressing THP-1 cells by the lentiviral system ...
-
bioRxiv - Immunology 2019Quote: ... expressing 4T1 tumor cells were generated by transducing cells with lentiviral vector carrying GFP gene (phage ubc nls ha pcp gfp plasmid, Addgene Plasmid #64539).
-
bioRxiv - Systems Biology 2019Quote: Puromycin-resistant Tet-based inducible cDNA expression system (pSLIK-Puro) was engineered by replacing the hygromycin-resistant gene in pSLIK-Hygro vector (a gift from Iain Fraser, Addgene plasmid # 25737) with a puromycin-resistant gene obtained from lentiGuide-Puro by PCR amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2020Quote: ... Homology directed repair donor plasmids were generated using a combination of gene synthesized DNA sequences for ∼ 225 bp homology arms and either mAID-mCherry2 derived from plasmids pMK292 (Addgene plasmid 72830) for C-terminal tagging ...
-
bioRxiv - Systems Biology 2021Quote: ... The IRES-SV40/NLS-MCP gene sequence together with full-length mVenus gene amplified from pTriEx-NTOM20-mVenus-Zdk2 (Wang et al., 2016) (gift from Klaus Hahn; Addgene plasmid #81011) was inserted after the stop codon of synTF in pEA01 ...
-
bioRxiv - Cell Biology 2021Quote: The pFHL-plasmid for dual expression was constructed using four DNA fragments: (i) the Kanamycin resistance gene and ColE1 origen of replication from a C1 plasmid (Addgene plasmid #54842), followed by (ii ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-nls-luciferase-FLAG (control) and AAV-hSyn1-Ptprt-ICD-FLAG were constructed from the backbone of AAV-hysn1-GCaMP6s-P2A-nls-dTomoto (Addgene gene, # 51084). AAV-hysn1-GCaMP6s-P2A-nls-dTomoto was digested with BamH1 and EconR1 ...
-
bioRxiv - Biochemistry 2021Quote: a codon optimised nagK gene from Plesiomonas shigelloides was cloned into the pOPINS3C expression plasmid (N-terminal polyhistidine and SUMO tags; Addgene #41115 (59)) ...
-
bioRxiv - Genomics 2020Quote: ... Plasmid pOsTIR1w/oGFP (for integrating the Oryza sativa TIR1 gene into the HO locus in yeast) was purchased from Addgene (Watertown, Massachusetts). pMK152 plasmid (for degron tagging CDC19 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 4,000 sgRNAs targeting screen hits and OR gene control sgRNAs were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid # 52961), with an additional G added in the beginning of the sgRNA sequence when indicated (Table S3O).
-
bioRxiv - Neuroscience 2022Quote: ... placed upstream of GFP for histology and gene expression experiments, and upstream of GCaMP7f (Dana et al., 2019) (modified from Addgene plasmid #104495), or a conditional version of GCaMP8s (Zhang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pAAV-EF1a-FLuc plasmid was generated by replacing the TdRed sequence in pAAV-EF1a-TdRed (unpublished, see below) with the FLuc gene with the regulatory WPRE region from pAAV-CAG-FLuc (Addgene Cat# 83281). Restriction enzymes BamHI-HF and SalI-HF were used to release the 3.4 kb vector band from pAAV-EF1a-TdRed as well as the 2.3kb FLuc-WPRE sequence from pAAV-CAG-FLuc ...
-
bioRxiv - Microbiology 2023Quote: The ISRE-Luc reporter plasmid (32) (25 ng) was either transfected alone or co-transfected with a plasmid expressing SARS-CoV-2 genes NSP13 (Addgene, cat. 141379) (25 ng) ...
-
bioRxiv - Microbiology 2023Quote: ... Two gRNA binding sites near the 3’ region of each gene of interest were identified using EuPaGDT Editing of the previously modified pTREX-n-Cas9 plasmid 51 (Addgene plasmid 68708), performed to exchange the previous gRNA sequence was achieved using a Q5 mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... which involved the co-transfection of the plasmid containing the CDC50A target sequences and the Cas9 gene with a donor plasmid (pDonor-tBFP-NLS-Neo; Addgene plasmid #80766) referred to as Donor ...
-
bioRxiv - Genetics 2023Quote: ... The puromycin resistance gene was then subsequently replaced with EGFP using an amplified fragment from the pMLS-SV40-EGFP plasmid 126 (Addgene plasmid # 46919). The expression and activity of the single-vector CROPseq plasmid was tested by cloning in a sgRNA targeting the DNMT3B (sgRNA sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were co-transfected using the PEI method with the lentiviral expression vector and two 2nd generation lentiviral packaging vectors: pMD2.G expressing the VSV-G envelope gene (Addgene plasmid 12259) and pCMVR8.74 expressing the gag/pol genes (Addgene plasmid 22036) ...
-
bioRxiv - Neuroscience 2023Quote: ... A 10-sgRNA-per-gene CRISPR/Cas9 deletion library (Human CRISPR Knockout library was a gift from Michael Bassik (Addgene # 101926-101934)) was infected into Cas9-expressing U937 cells as described16 ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Cell Biology 2023Quote: ... MCF-7 or HeLa single cell colonies were selected from cells transduced with the following sequences targeting human genes cloned into lentiCRISPR v2 (Addgene no. 52961):
-
bioRxiv - Synthetic Biology 2024Quote: ... Genes encoding natural transcription factors were sourced from: cJun (pCLXSN-c-JUN, which was a gift from Jin Chen, Addgene plasmid #102758)36 and BATF (pFUW-TetO-BATF ...
-
bioRxiv - Immunology 2023Quote: ... and 10µg HRE-luciferase (a gift from Navdeep Chandel, this plasmid contains three copies of a HRE from the Pgk1 gene; Addgene plasmid #26731) in a 1.5:1 ratio with FuGene (#E2311 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Molecular Biology 2024Quote: ... The insert containing CGG repeats within the 5’UTR of FMR1 gene fused with EGFP sequence was derived from 5’UTR CGG 99x FMR1-EGFP (Addgene plasmid #63091). The insert was ligated into the vector instead of EGFP sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... pRRL-hPGK-mCherry-P2A-PuroR-T2A-FLAG-APEX2 was created by PCR amplifying hPGK-mCherry-P2A-PuroR-T2A from a synthesised gene fragment purchased from GeneWiz and APEX2 from pcDNA3-FLAG-APEX2-NES (a gift from Alice Ting67, Addgene plasmid # 49386) followed by insertion into PCR linearised pRRL backbone ...
-
bioRxiv - Cancer Biology 2024Quote: To generate ER-Hoxa9 mCherry-Geminin cells, the mCherry-Geminin fusion gene (Sakaue-Sawano et al., 2008) was cloned into the pLV-Hygro vector (Addgene plasmid #85134), using Gibson cloning ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid used to subclone the CFP was a gift from Alice Ting.(67) The pcDNA3-ER-GCaMP3 plasmid from which the cpGFP gene was subcloned was a gift from Jin Zhang (Addgene plasmid # 64854).(68 ...
-
bioRxiv - Microbiology 2023Quote: ... ∼1,000 bp directly upstream and downstream of the l-ldh gene were amplified for each strain and the PCR products were cloned into the pIMAY (for S. epidermidis NIHLM087; Addgene Plasmid #68939) and pJSC232 (for C ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Bioengineering 2020Quote: ... pMD2.G containing VSV-G envelop protein (Addgene, #12259) and pCMVΔR8.2 (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Physiology 2022Quote: ... or tdTomato-EB3 fusion protein (Addgene, EB3-tdTomato, #50708) was performed as 5 repeated measurements × 5 cells × 3 independent experiments ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Immunology 2022Quote: Gene targeting by CRISPR/Cas9 was accomplished by dual- transfection of pX458 (GFP) and pX459 (puromycin) Cas9-expression vectors (Addgene, 48138; Addgene, 62988) containing paired RNA guides flanking the TRP2180-188 epitope ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral particles carrying a luciferase reporter were produced at the EPFL Gene Therapy Facility by transfecting HEK293 cells with the pHIV-Luc-ZsGreen plasmid (Addgene, Catalog No. 39196). Lentivirus-containing supernatants were collected and concentrated by centrifugation (1,500 g for 1 hr at 4°C) ...
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...