Labshake search
Citations for Addgene :
651 - 700 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were immortalized by human telomerase gene (hTERT) using the retrovirus vector pLXSN-hTERT or the lentivirus vector pCLX-PGK-hTERT vector (#114315, Addgene). Retrovirus and lentivirus preparations ...
-
bioRxiv - Physiology 2020Quote: Lentiviruses were produced by transient transfection of HEK293T cells with lentiviral vectors carrying the gene of interest and pMD2.G (12259; Addgene) and psPAX2 (12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... the pac gene was amplified from pBABE-puro plasmid (kindly provided by Jay Morgenstern and Hartmut Land, Addgene plasmid #1764) (Morgenstern and Land ...
-
bioRxiv - Neuroscience 2021Quote: ... the Igk-TATk-hCDKL51 or hCDKL51 gene expression cassettes were subcloned in the backbone of pAAV-CBh-DIO-EGFP (plasmid #87168, Addgene). The designed viral cassettes between the two AAV2 inverted terminal repeats (ITRs ...
-
bioRxiv - Biochemistry 2020Quote: ... HA-HIF-1α was linearized with BamHI and had the clover gene amplified from the pcDNA3-Clover plasmid (Addgene #40259). To generate HA-Clover ...
-
bioRxiv - Microbiology 2020Quote: ... The pCAGGS-NP-EBOV plasmid encoding the Zaire EBOV NP gene was a gift from Elke Mühlberger (Addgene plasmid #103049) (59) ...
-
bioRxiv - Developmental Biology 2019Quote: Two gRNAs targeting loci near the start codon of the Rho kinase gene were cloned into pCFD3 vector (Addgene 49410) following the protocol from (Port et al. ...
-
bioRxiv - Biochemistry 2021Quote: SARS-CoV-2 S-Pseudotyped lentivirus27,43 were produced by co-transfection of HEK-293T cells with plasmids bearing a GFP reporter gene (pLB was a gift from Stephan Kissler, Addgene plasmid #11619 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Cell Biology 2020Quote: Editing of the SFXN1 gene was carried out using the pSpCas9(BB)-2A-GFP CRISPR-Cas9 construct (a gift from F. Zhang; Addgene) (Ran et al. ...
-
bioRxiv - Microbiology 2020Quote: A human Brunello CRISPR knockout pooled library encompassing 76,441 different sgRNAs targeting 19,114 genes(Doench et al., 2016) was a gift from David Root and John Doench (Addgene #73178), and amplified in Endura cells (Lucigen #60242 ...
-
bioRxiv - Cell Biology 2021Quote: ... All the plasmids for Genome-wide CRISPR library generation (GeCKOv2) and individual gene knockouts were procured from Addgene (MA, USA). CellLight Tubulin-RFP / GFP ...
-
bioRxiv - Immunology 2022Quote: ... against the respective genes were designed with e-crisp.org [76] and cloned into the expression vector LentiCRISPRv2 (Feng Zhang, Addgene #52961). Lentiviral particles were produced by transiently transfecting HEK 293T cells with a total of 15 µg DNA consisting of the plasmids pCMV-dr8.91 (coding for HIV gag-pol) ...
-
bioRxiv - Biophysics 2022Quote: ... This resulted in the plasmid pASK-IBA5-chiP which was further used as the template for cloning the chiP gene into pET19b plasmid (Addgene). This was done using the primer pairs pET19b-chiP and chiP-pET19b with the Gibson cloning method (Table S2) ...
-
bioRxiv - Neuroscience 2023Quote: ... consisting of a loxP site and rox-flanked hygromycin and zeocin resistance genes from pNeDaKO-Hyg (Addgene plasmid #16414; (60)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Microbiology 2023Quote: The construct pFUS ΔIDR-YFP was created by PCR amplifying the fus gene from pGST- TEV-FUS (a kind gift from Dr. Aaron Gitler; Addgene plasmid # 29629 ...
-
bioRxiv - Neuroscience 2023Quote: ... sfGFP genes were amplified by PCR from pJT119b plasmid which was kindly gifted by by Jeffrey Tabor (Addgene plasmid #50551), and cloned into pETcon-alpha syn ...
-
bioRxiv - Cancer Biology 2023Quote: The lentiviral construct for the constitutive expression of the bioluminescence (firefly luciferase) and the red fluorescence (mCherry) was generated by amplifying the cDNA encoding both genes from Addgene Plasmid #44965 and cloned in the lentivirus backbone (Addgene #12262 ...
-
bioRxiv - Bioengineering 2023Quote: ... and a plasmid containing both an empty sgRNA scaffold as well as a gene sequence encoding SpCas9 (AddGene plasmid# 57819) with a final goal of LV positive control vector generation ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Jump-in TurboID cell lines were prepared by co-transfecting HEK293T cells with 1.0 μg and 1.5 μg of attb-BSDr containing the gene of interest and pCMV-Int (ΦC31-integrase, Addgene 18935) plasmids respectively ...
-
bioRxiv - Genetics 2023Quote: ... we first deleted the ORF with a cassette containing the hygromycin resistance marker (hphRMX) fused to the herpes simplex virus thymidine kinase-encoding gene (HSV-TK) from the pFA6a-HyTkAX vector (Addgene plasmid # 73898 ...
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Bioengineering 2023Quote: ... near a Cas9 fused tracrRNA-crRNA fusion to replace the RFP and LacI genes in a PCR’ed fragment of pBbS2K-RFP (Addgene #35330). The Golden Gate assembly cassettes of the resulting plasmid (called pSECRETS-B ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRHR gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and instead containing the fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was infused into ACC in 4 animals as a null virus control ...
-
bioRxiv - Cell Biology 2023Quote: ... Trunctated constructs were synthesised (Gene universal) and subcloned into gateway entry vectors before being recombined into the lentiviral expression plasmid pLX_TRC311 (Addgene, #11368). 1205Lu cells were then stably transduced with either pLX-eGFP-CLASP1-N (TOG1-2 ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNMT3A2E756A gene was synthesized by IDT and cloned into pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40 (Addgene #186968).
-
bioRxiv - Molecular Biology 2023Quote: ... and the lentivector backbone was Gibson-assembled with a miniU6-tracrRNA gene block and U1a-SpyCas9 amplified by PCR from Addgene plasmid #121507 ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Molecular Biology 2024Quote: A CRISPR-Cas9 plasmid targeting the region adjacent to the start codon of the ATAD5 gene (CACCGGCTGTGGTACCAGGTCACG/agg) was constructed using pX330-U6-Chimeric_BB- CBh-hSpCas9 (Addgene 42230) (Ran et al ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was used for the production of the dsRNAs targeting AePer50 THI-and PKT-gene and the plasmid template pUC57 (Addgene) was used for dsGFP (used as control dsRNA) ...
-
bioRxiv - Microbiology 2024Quote: ... The two fragments upstream and downstream of the mfd gene were cloned at each side of the chloramphenicol cassette (CatR) from the pDK3 plasmid (Addgene) into the pUC57 vector (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Synthetic Biology 2024Quote: Genes encoding each ligand were sourced from: VEGFA165 (pVax1-hVEGF165, which was a gift from Loree Heller, Addgene plasmid #74466)28 ...
-
bioRxiv - Neuroscience 2024Quote: The AAV carrying the gene for a genetically encoded calcium indicator (pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene plasmid #104492) was injected unilaterally into the right mPFC (1.5 mm ventral from brain surface ...
-
bioRxiv - Cancer Biology 2024Quote: ... two sgRNAs were synthesized together with bovine U6 promoter as gene blocks (Integrated DNA Technologies) and cloned using Gibson assembly into LRG2.1T (Addgene, 65656). All inserts were verified by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18α and Mis18β genes were cloned into expression vectors pET His6 TEV (9B) and pET His6 msfGFP TEV (9GFP, Addgene plasmids #48284 and #48287 ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Cell Biology 2023Quote: ... to co- transfect HEK 293FT cells with plasmids containing the packaging gag/pol and envelope pCMV- 435VSV-G genes and either the pMRX-IB-HaloTag7-mGFP-KDEL (Addgene, 184904 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...