Labshake search
Citations for Addgene :
701 - 750 of 1157 citations for Rat Phosphatidic Acid Phosphatase Type 2A PPAP2A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with a mixture of pSpCas9(BB)-2A-GFP plasmids (gift from Feng Zhang; Addgene plasmid #48138) containing two different sgRNA sequences (TTGGATGACTCGGACTCGCT and CGCTTGGTGATTCCATGTAA ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plasmids encoding the wild-type SpyCas9 (px330, Addgene #42230) or its catalytically enhanced variant ...
-
bioRxiv - Cell Biology 2020Quote: Human PKM2 wild-type construct was purchased from Addgene (44242) and sub-cloned to pCMV-Tag2B plasmid (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Bioengineering 2023Quote: ... Pae Type I Cascade plasmids encoding Csy1-Csy2 (Addgene #153942) and Csy3-VPR-Csy4 (Addgene #153943 ...
-
bioRxiv - Bioengineering 2023Quote: ... and Pae Type I Cascade System (Addgene #153942 and 153943), YAP-S5A (Addgene #33093 ...
-
bioRxiv - Microbiology 2022Quote: The pCMV-myc-SFPQ wild-type (WT) (Addgene Plasmid #35183)(Rosonina et al ...
-
bioRxiv - Microbiology 2023Quote: ... the pHG165a plasmid encoding wild-type Cra (Addgene ID 90066) was transformed into the E ...
-
bioRxiv - Cell Biology 2020Quote: ... were designed and cloned into the pSpCas9n(BB)-2A-Puro (PX462) V2.0 plasmid (a gift from Feng Zhang, Addgene plasmid #62987). Homology arms containing the 5’-UTR ...
-
bioRxiv - Genomics 2021Quote: ... Cells were transfected for five hours with 60 μl of Lipofectamine 2000 and 10 μg of each of the plasmids pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) and pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Cell Biology 2022Quote: ... These oligos which contain BbsI restriction sites were annealed creating overhangs for cloning of the guide sequence oligos into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid 62988) by BbsI digestion ...
-
bioRxiv - Immunology 2021Quote: HuT78 cells were transfected with 2.5 μg of pSpCas9(BB)-2A-GFP sgRNA expression vectors (a gift from Feng Zhang, Addgene plasmid # 48138) [47] using Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2019Quote: Gene knock-out was performed using transient transfection of pSpCas9(BB)-2A-Puro (PX459) V2.0 (a gift from Feng Zhang, Addgene plasmid #62988). Oligonucleotides encoding sgRNA protospacer sequences (Extended Data Table 5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... OsTIR1 was integrated into the genome by CRISPR-Cas9 mediated repair using an sgRNA targeting AAVS1 safe harbor locus cloned into pSpCas9(BB)-2A-GFP from Feng Zhang (PX458, Addgene #48138) (Mali et al ...
-
bioRxiv - Bioengineering 2021Quote: ... by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152). We inserted the TRS-Leader immediately before the coding sequence by ligation of annealed oligos (see Supplementary Table 3 for sequences) ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... construct was engineered by replacing mCherry coding sequence with iRFP670-2A-PuroR cassette in pU6-(BbsI)-CBh-Cas9-T2A-mCherry plasmid (Addgene 64324) by Gibson assembly ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... Oligo nucleotides containing CRISPR target sequences (5’-CCGGCCGGGCCTACGGCTTG-3’) were annealed and ligated into pSpCas9 (BB)-2A-GFP (PX458) (Addgene 48138). Then ...
-
bioRxiv - Immunology 2020Quote: ... Coding sequences of human full-length TREM2 (NM_018965.3) and the Δe2 isoform were synthesized and cloned into the doxycycline-inducible lentiviral pCW57-MCS1-2A-MCS2 vector (Addgene, #71782). For “add-back” experiments ...
-
bioRxiv - Molecular Biology 2020Quote: An sgRNA targeting the MDC1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Immunology 2022Quote: ... and for human p53 (sgRNA: 5’-GCATCTTATCCGAGTGGA-3’) was already cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0 (Addgene plasmid #62988)) and kindly provided by Daniel Hinze from the lab of Michael Hölzel ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were synthesized and subcloned into the BsmBI site of the all-in-one (dox-inducible Cas9-2A-eGFP and constitutive U6 promoter) TLCV2 vector (Addgene #87360). sAC-targeted sgRNAs ...
-
bioRxiv - Biophysics 2022Quote: For biolayer interferometry experiments protease 2A from CV-B3 was sub-cloned into LIC cloning vector 2Bc-T (Addgene plasmid # 37236) with a C-terminal His6-tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCAAGATGATCCCAATGAGT) or Ifngr2-targeting sgRNAs (3’-gRNA-‘5: AGGGAACCTCACTTCCAAGT) were cloned into target vector px458-pSpCas9(BB)-2A-GFP (Addgene #48138) or px459-pSpCas9(BB)-2A-Puro (Addgene #62988) ...
-
bioRxiv - Cell Biology 2022Quote: ... were designed using the CRISPR design tool at (https://benchling.com) and cloned into pX458 (pSpCas9 BB-2A-GFP, Addgene plasmid # 48138). Multiple single-cell derived knockout clones per each guide RNA were isolated and screened for the gene disruption by western blotting ...
-
bioRxiv - Cancer Biology 2022Quote: The crRNAs targeting 1 and 11 introns of the CCDC6 and RET genes respectively were designed using E-CRISP (e-crisp.org) 31 and cloned into pSpCas9(BB)-2A-GFP (PX458) construct which was a gift from Feng Zhang (Addgene plasmid #48138) 32 ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... gRNAs were designed using an online CRISPR design tool (DESKGEN) and were cloned into the pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene: #48139). To test gRNA efficiency a T7 endonuclease assay was performed ...
-
bioRxiv - Molecular Biology 2020Quote: ... an oligo duplex encoding the sgRNA sequence was cloned at the Bbs I site of pX458-pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). To construct a donor vector ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pSpCas9(BB)-2A-Puro (px459) was originally created in the Zhang lab (Broad Institute, Cambridge, MA, US) and purchased from Addgene (#62988). NanoBiT plasmids pBiT1.1-N_[TK/SmBiT] and pBiT2.1-N_[TK/LgBiT] were purchased from Promega (cat n° N2014).
-
bioRxiv - Genetics 2022Quote: Complementary gRNA oligos were designed with overhangs facilitating golden gate assembly and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) according to Ran et al ...
-
bioRxiv - Genetics 2022Quote: ... Complementary gRNA oligos were designed with overhangs facilitating golden gate assembly and cloned into pSpcas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) according to Ran et al ...
-
bioRxiv - Neuroscience 2019Quote: ... Reference sequences of the viral samples used in this study were based on deposited plasmids in Addgene: pSAD-F3-NPEST-iCRE-2A-mCherryPEST (Addgene #99608), pSAD-F3-NPEST-FLPo-2A-mCherryPEST (Addgene #99609) ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCTCGTTCAGCACGGCCTCCA and reverse 5’- aaacTGGAGGCCGTGCTGAACGAGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987). To knock in eGFP into either the MFF or FIS1 loci ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCATTTAAATACAGTAAATAC and reverse 5’- aaacGTATTTACTGTATTTAAATGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987)10.
-
bioRxiv - Cell Biology 2020Quote: Oligo duplexes containing a single guide (sg)RNA sequence for ACLY (as shown in Figure 1-figure supplement 1A) were inserted into pCas9(BB)-2A-GFP (a gift from Feng Zhang, Addgene #48138) following the published procedures (Ran et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The oligonucleotides were annealed and inserted into the BbsI site of pSpCas9(BB)-2A-Puro(PX459)V2.0 (Addgene, Watertown, MA, USA), which has Cas9 and gRNA expression vectors ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sgRNA targeting the gene body of PHAROH was cloned into a pSpCas9(BB)-2A-GFP vector (PX458, Addgene plasmid #48138) and the sgRNA targeting the upstream promoter region was cloned into a pSpCas9(BB)- 2A-mCherry vector ...
-
bioRxiv - Cancer Biology 2019Quote: To produce gRNA the following DNA oligos purchased from IDT were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene Plasmid #62988), using the protocol in 64) ...
-
bioRxiv - Genetics 2020Quote: Human codon-optimized high fidelity Cas9 nuclease construct with GFP tag (pSpCas9(BB)-2A-GFP (PX458))80 was obtained from Addgene (#48138). Two sgRNAs were designed using CRISPR-Cas9 guide RNA design checker from Integrated DNA Technologies ...
-
bioRxiv - Immunology 2020Quote: ... GTG ACT GGC CAA GCC GTA G) were synthesised according to Sanjana et al (28) and cloned into pSpCas9(BB)-2A-GFP (Addgene, #48138) following BbsI digestion ...
-
bioRxiv - Cell Biology 2019Quote: ... ErkKTR-iRFP-2A-H2B-tRFP was cloned by PCR amplification of the 2A cleavage site from pTiger-OptoSOS and amplification of the H2B-tagRFP coding sequence (a gift from Sergi Regot; Addgene 99271), followed by insertion into pHR ErkKTR-iRFP ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...