Labshake search
Citations for Addgene :
751 - 800 of 1157 citations for Rat Phosphatidic Acid Phosphatase Type 2A PPAP2A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PX458-AAVS1 construct used to target the AAVS1 locus was generated by cloning the AAVS1_sgRNA sequence into pSpCas9(BB)-2A-GFP (PX458) (a gift from Dr Fang Zhang, Addgene plasmid # 48138) as previously described by Ran et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... ΔPPXY)-T2A-GFP were generated by PCR from pCDNA4/TO-HA-NLS-SV40-B-MYB (this work) and pSpCas9n(BB)-2A-GFP (PX461) (Addgene #48140). All entry vectors were subcloned into pENTR3C (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: To generate CRISPR-Cas9 targeting constructs we used the pSpCas9n(BB)-2A-Puro V2.0 (Px462v.2, a gift from Feng Zhang, Addgene plasmid #62987). Px462v.2 plasmid [3] was simultaneously digested and ligated to annealed oligo duplexes diluted 1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Tsc2-/- MEFs lacking Atf4 were generated by CRISPR-Cas9 mediated deletion using pSpCas9n(BB)-2A-GFP (PX461) vector (Addgene, 48140) according to the previously described protocol (Ran et al. ...
-
bioRxiv - Genomics 2020Quote: ... The VP64 cassette was replaced by CTCF sequences to generate dCas9-CTCF and neomycin resistant marker that was taken from pAC95-pmax-dCas9VP160-2A-neo (a gift from Rudolf Jaenisch, Addgene 48227) was inserted ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Genetics 2020Quote: ... DNA oligos encoding guide RNAs (gRNA) were synthesized (IDT) and cloned into pSpCas9(BB)-2A-Puro vectors (gift from Feng Zhang, Addgene #62988) according to the protocol here (46) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8-EF1a-DIO-H2B-GFP-2A-OG (10min, 1.54 × 1013 genome units per ml, custom packaged by Vigene Biosciences, Addgene plasmid #74289) was delivered through iontophoresis into target subregions in double transgenic mice of CaMKIIα-Cre ...
-
bioRxiv - Cell Biology 2021Quote: ... and pCC_05 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9-NLS-VPR-2A-Puro-WPRE (Addgene 139090, Legut et al, 2020). Oligonucleotide sequences for single guide RNAs (sgRNAs) ...
-
bioRxiv - Neuroscience 2022Quote: ... the RFP in the pLV-hSYN-RFP backbone was replaced with the TurboGFP(tGFP)-P2A from pCW57-GFP-2A-MCS (Addgene #71783)(Barger et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cloning them into the sgRNA scaffold of a CRISPR/cas9 vector using BbsI restriction sites [pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #62988)] ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide sequence 5’- GCCCCCAGCCTCTGCGG-3’ was cloned into the vector pSpCas9(BB)-2A-eGFP (PX458 plasmid a gift from Feng Zhang, Addgene #48138). Homology directed repair templates were designed to contain 1000bp homology arms flanking the region to be edited ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Immunology 2022Quote: ... pTRIP-SFFV-Hygro-2A-mScarlet-VPS4A E228Q was obtained by Gibson assembly of PCR amplified VPS4A E228Q from pEGFP-VPS4-E228Q (Addgene #80351). pTRIP-SFFV-Hygro-2A-mScarlet-UBAP1DN and pTRIP-SFFV-Puro-2A-mScarlet-UBAP1DN (truncated mutant at residue 97 - mutation G98X ...
-
bioRxiv - Immunology 2022Quote: ... pTRIP-hPGK-Blast-2A was cloned from pTRIP-CMV-STING-GFP (kind gift of Nicolas Manel) by Gibson assembly of PCR amplified hPGK from pCW57-MCS1-2A-MCS2 (Addgene #71782) and a gBlock (IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... CM-005046-01-0002), the transactivating CRISPR RNA, tracrRNA: (Horizon, U-002005-05) and pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138), folliwing the Edit-R™ CRISPR-Cas9 Gene Engineering System (Dharmacon) ...
-
bioRxiv - Plant Biology 2022Quote: ... AA106 and AA107) and mNeonGreen (primer pair: AA108 and AA109) were amplified from Zea mays B73 cDNA and mNeonGreen-2A-mTurquoise2 (Addgene #98885), respectively ...
-
bioRxiv - Neuroscience 2023Quote: A subset of Vglut2-Cre and wild type mice used in the motorised treadmill experiments had received a bilateral CnF injection of 23 nL AAV2-EF1a-DIO-iChloc-2A-dsRed (titer 1.1 × 1014, SWC VVC from Addgene plasmid 70762), but showed no discernible reaction to the optical stimulus ...
-
bioRxiv - Molecular Biology 2023Quote: ... CRISPR gRNAs were designed using Benchling software (http://benchling.com/) and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (plasmid #62988, gift from Feng Zhang, Addgene, Cambridge, MA, USA) (Supplemental Table 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... These oligos contained BbsI restriction sites and were annealed to create overhangs for cloning of the guide sequence oligos into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid 62988) by BbsI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotide containing the CRISPR target sequence was annealed and ligated into Bbs1 linearized pSpCas9(BB)-2A-Puro (PX459) vector (Addgene #48139). HepG2 cells were transfected with PX459-p62 with X-tremeGENE HP transfection reagent (Roche) ...
-
bioRxiv - Genomics 2023Quote: We assembled the CRISPR/Cas9 vectors by annealing pairs of oligos carrying the sgRNA sequences and cloning them into pSpCas9(BB)-2A-Puro (PX459) (Addgene #62988) as described60 ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... that created a double stranded break close to the mutation (sequence: CCAGATCCACTGCTGTCAGG) and cloned in pSpCas9(BB)-2A-Puro (Addgene, 48139).
-
bioRxiv - Cell Biology 2023Quote: STING1 KO HMC3 cells were generated using the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector kindly gifted by Feng Zhang (Addgene plasmid #62988)73 containing the following single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting a common exon of splicing variants of each gene of interest were cloned into BBsI-linearised pSpCas9(BB)-2A-GFP vector (Addgene #48138) using NEBuilder® HiFi DNA Assembly (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... and HA-tag were introduced by CRISPR/Cas9-mediated homologous recombination to the N-terminus of ZBTB24 protein (gRNAs are listed in Table S9 were cloned in pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138), the plasmids containing HA tag ...
-
bioRxiv - Cell Biology 2023Quote: ... They were then cloned into a pCCC vector which is based on pSpCas9(BB)-2A-GFP vector (PX458, Addgene plasmid # 48138). The pCCC vector contains the complete U6 promoter for enhanced expression in hiPSCs ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed oligos were diluted 250-fold with water and used for ligation with the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, Cat# 62988), which was predigested with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... LS174T ERN1-/- cells and LS174T ERN2-/- cells were constructed by transfection with pSpCas9(BB)-2A-GFP (Feng Zhang lab, Addgene #48138) containing sequences for guides targeting exon 8 (WGE ID’s 1150303698 and 1150303744 for ERN1 ...
-
bioRxiv - Genomics 2023Quote: ... This integration was generated by co-transfection of the donor vector pEN396-pCAGGS-Tir1-V5-2A-PuroR TIGRE (Addgene plasmid, #92142) and Cas9-gRNA plasmid pX459-EN1201 (backbone from Addgene plamid #62988 ...
-
bioRxiv - Cell Biology 2023Quote: ... the oligonucleotides were annealed and cloned into the BbsI site of dual Cas9 and sgRNA expression vector pSpCas9(BB)-2A-Puromycin (Dr. Feng Zhang laboratory, Addgene, #48139). The plasmids were transfected into HeLa cells using TurboFect Transfection Reagent (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Initiative for Genome Editing and Neurodegeneration core in the Department of Cell Biology at Harvard Medical School) or cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) and transfected into HEK293FT using Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the mouse synaptophysin-mRuby fusion protein was cloned into the generated synapsin:eGFP transgene from AAV-FLExloxP-mGFP-2A-synaptophysin-mRuby (Addgene Plasmid# 71760) plasmid vector courtesy of Liqun Luo (Beier et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) [16] ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting exons 6 or 10 of CTPS1 or exons 5 and 10 of CTPS2 were designed as previously described [39] and cloned in the LentiCRISPR V1 (pXPR_001) or pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid 48138) vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... were made by ligation of double-stranded antisense/sense oligos to the short guide RNAs (sgRNAs) of interest in pSpCas9(BB)-2A-GFP (PX458; Addgene #48138) and pSpCas9(BB)-2A-RFP plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the arginine finger region of SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the patient-specific mutation in SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Cell Biology 2023Quote: ... These oligos which contain BbsI restriction sites were annealed creating overhangs for cloning of the guide sequence oligos into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) by BbsI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Oligonucleotides for cloning guide RNA into the pSpCas9 (BB)-2A-GFP vector (48138; a gift from F. Zhang, Addgene, Cambridge, MA) were designed as described previously (Ran et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Neuroscience 2023Quote: ... The double-strand DNAs containing the gRNA sequence were synthesized and subcloned into the MluI/SpeI site of pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA (Addgene, #113702) (44) ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... ENST00000396265.4 TSPO-203) using Benchling (Benchling software, 201941) and cloned into either a pSpCas9(BB)-2A-GFP (PX458; Addgene plasmid #48138) plasmid or a pU6-(BbsI)_CBh-Cas9-T2A-mCherry plasmid (Addgene plasmid #64324 ...