Labshake search
Citations for Addgene :
601 - 650 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... the ADH1 terminator coupled to 3xHA tag was amplified from plasmid pFA6a-3HA-His3MX6-n9 (Addgene Reference #41600); PtSeipin coding sequence was amplified from the pPha-PtSeipin-eGFP previously obtained ...
-
bioRxiv - Cell Biology 2020Quote: ... The HA-GLUT4-mEos3.2 cDNA construct was generated by replacing GFP in the HA-GLUT4-GFP cDNA construct for mEos3.2 (Addgene plasmid #54525) (43 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Actin promoter and EGFP cDNA were replaced respectively with the TRE3G promoter and rtTA cDNA from inducible Caspex expression plasmid (Addgene). PCR was performed using PrimeSTAR MAX (TAKARA ...
-
bioRxiv - Microbiology 2021Quote: ... pRSET his-eGFP [76] was used as a backbone and was a gift from Jeanne Stachowiak (Addgene plasmid # 113551). Wild-type IDR was PCR amplified from a full-length PEMV2 infectious clone ...
-
bioRxiv - Neuroscience 2021Quote: ... and retrograde AAV encoding Cre recombinase (AAVretro-hSyn-HI-eGFP-Cre (titer 1.17 x 1013 GC/ml, Addgene 105540) were stereotaxically injected into S2 or M1 and nwS1 ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid pBAD-His-6-Sumo-TEV-LIC cloning vector (8S) was a gift from Scott Gradia (Addgene plasmid 37507). The plasmid was modified via restriction enzyme digestion (final construct ...
-
bioRxiv - Cell Biology 2020Quote: ... Histidine-tagged ubiquitin (pCI-His-hUbi, #31815) and Ha-tagged p62 (HA-p62, #28027) plasmids were purchased from Addgene. DNA constructs corresponding to the mature form of human UBTD1 were subcloned from pEGFP-N1 (Novagen ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV injections consisted of a 1:10 cocktail of Cre [AAV5-CMV-HI-eGFP-Cre.WPRE.SV40 (Addgene plasmid no. 105545) packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no ...
-
bioRxiv - Neuroscience 2024Quote: ... the CaMPARI2 gene (1446 bp) was subcloned from pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 (Addgene 101060, gift from Eric Schrieter)26 into a lentiviral plasmid (pRT050 ...
-
bioRxiv - Cell Biology 2023Quote: ... Mis18BP120-130 was cloned in pEC-K-3C-His-GST and pET His6 MBP TEV (9C Addgene plasmid #48286).
-
bioRxiv - Molecular Biology 2024Quote: ... LOX-1 tagged with V5-6×His at the C-terminus (V5-LOX-1) was subcloned into pmScarlet_C1 (plasmid #85042; Addgene) (mScarlet-LOX-1) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Cell Biology 2021Quote: ... Wild-type Cdc42 cDNA was obtained from Addgene and subcloned into pRK5 with a Myc tag at the N-terminus ...
-
bioRxiv - Genetics 2021Quote: ... Jun and Egr2 cDNAs were derived from Addgene plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: EIF2A cDNA was cloned from pDONR223_EIF2A_WT (Addgene, 82111). EIF2A-TEV-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... Resulting fragments and mCherry cDNA amplified from Addgene plasmid #102245 were assembled using Gibson Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNAs were cloned into pLenti (Addgene #22255) or pMSCV (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA constructs were designed and obtained from Addgene, scaled in house using DH5α transformation competent cells (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Myc cDNA in pWZL Blast myc (Addgene #10674) was replaced with H-Ras V12 cDNA from pBABE-puro H-Ras V12 (Addgene #9051 ...
-
bioRxiv - Molecular Biology 2024Quote: The cDNA fragment for mTurqoise2 (Addgene plasmid #54843) was modified by overlapping extension PCR (polymerase chain reaction ...
-
bioRxiv - Neuroscience 2024Quote: Human RBFOX1 cDNA (from pENTR-A2BP1, Addgene, 16176) or human U2AF2 cDNA (from pCDNA3-U2AF65-DYK ...
-
bioRxiv - Bioengineering 2024Quote: ... PIK3CAE542K cDNA was amplified from pHAGE-PIK3CAE542K (Addgene, plasmid # 116479 ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... a chimeric coding sequence consisting of an N’-terminal HiBit (pEPYC0CM0258, Addgene T.B.C.) the uidA coding sequence ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids constructs pSBbi-RN-FGF19 and pSBbi-BB-FGF15 were respectively generated by cloning the human FGF19 amplified from Huh7 cDNA and the mice Fgf15 amplified from ileum cDNA onto the pSBbi-RN (Addgene #60519) and pSBbi-BB (Addgene #60521 ...
-
bioRxiv - Developmental Biology 2020Quote: - cloning of UAS-3HA-Enok: a three HA-tags encoding sequence was directionally inserted in the pUAStAttB vector (Addgene) polylinker using EcoRI and NotI restriction enzymes ...
-
bioRxiv - Biophysics 2022Quote: Escherichia coli NiCo21 (DE3) competent cells were transformed with the plasmid encoding sumo-tag fused DiCas7-11 (Addgene: 172503). A single colony was picked and transferred to 100mL LB media containing 50 μg/mL ampicillin and grown for 12 hours at 37°C before inoculation into 1L LB culture ...
-
bioRxiv - Cell Biology 2020Quote: ... The SNAP-Rpb1 construct was generated by sub-cloning the SNAP tag from the pSNAPf-C1 plasmid (Addgene 58186) into the NheI and SacII of the pHalo-Rbp1 plasmid (A gift from Darzacq lab) ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465 ...
-
bioRxiv - Microbiology 2023Quote: ... originally obtained from the laboratory of Sydney Kustu.94 Perturbations of intracellular ppGpp concentrations were performed using a genetic system as described in Büke et al.70 These plasmids (without fluorescent tags) were ordered from AddGene (pRelA’ AddGeneID:175595 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-eGFP, Addgene) was also infused bilaterally into either BLA (n=7) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3xHA tag (synthesized by Twist Biosciences) was subcloned into the pGP-AAV-syn-jGCaMP8s plasmid vector (Addgene: 162374). Viral vectors were commercially prepared (Virovek ...
-
bioRxiv - Microbiology 2024Quote: ... and H4 with C-terminal mEmerald (mEm) fluorescent tags were a gift from Michael Davidson and obtained from Addgene (Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of NIX (1-182aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223733). Point mutants were introduced by in vitro mutagenesis to generate NIX E72A/L75A/D77A/E81A (4A ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of BCL2L13 (1-465aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223744). Point mutants were introduced by in vitro mutagenesis to generate BCL2L13 W276A/I279A (ΔLIR1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FUNDC1 (1-50aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223734). Point mutants were introduced by in vitro mutagenesis to generate FUNDC1 Y18A/L21A (ΔLIR ...
-
bioRxiv - Neuroscience 2023Quote: ... an H2B-GCaMP6s middle entry clone was prepapred from Addgene plasmid #59530 and subsequently recombined with p5E_QUAS (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... KRAS4A and KRAS4B entry clones (Addgene plasmids 83166 and 83129) and ARAF ...
-
bioRxiv - Neuroscience 2023Quote: ... For the transfection with human Pdhk1 clone (hPdhk1; Addgene: 20564). Pre-OLs after partial differentiation for 4 days from the OPCs ...
-
bioRxiv - Genetics 2024Quote: ... To clone the two sgRNAs into lentiCRISPRv2 vector (Addgene, #52961), we amplified the sgRNA scaffold and mouse U6 promoter using two oligos containing the designed sgRNA sequences ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...