Labshake search
Citations for Addgene :
551 - 600 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Mus musculus Cdc50a cDNA and mCherry (Addgene) sequences were amplified by overlap PCR and subcloned into the AAV-CAG-GFP (Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA’s were obtained from commercially available (AddGene) sources and variants were introduced by performing overlapping PCR ...
-
bioRxiv - Cancer Biology 2024Quote: All cDNAs were either cloned from Addgene plasmids or synthesized as indicated below ...
-
bioRxiv - Cell Biology 2023Quote: ... we amplified the SERCA2b cDNA from Addgene plasmid #75188 using SERCA specific forward 5’-GGGAGATCTATGGAGAACGCGCACACCAAGACGG-3’ and reverse 5’-GGGGTCGACTCAAGACCAGAACATATCGCTAAAGTTAG-3’ primers with overhanging BglII and SalI sites for pEGFP-C1 vector insertion ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was obtained from Addgene (Plasmid #71458) and cloned into pLVX-IRES-mCherry (Takara Bio).
-
bioRxiv - Immunology 2024Quote: ... STAT1 cDNA was PCR-amplified from Addgene #8691 (a gift from Jim Darnell (Horvath et al ...
-
bioRxiv - Cell Biology 2024Quote: The following cDNAs were obtained from Addgene and the corresponding plasmids ...
-
bioRxiv - Molecular Biology 2024Quote: ... vector backbone carrying spCas9 cDNA from Addgene #48138 and mCat-1 cDNA from Addgene #17224 (see Note 1).
-
bioRxiv - Molecular Biology 2024Quote: ... vector backbone carrying spCas9 cDNA from Addgene #48138 and mCat-1 cDNA from Addgene #17224 (see Note 1).
-
bioRxiv - Cell Biology 2024Quote: ... Mouse Pgc1b (Addgene1031) and mouse Esrra (Addgene 172152) were subcloned into pLenti IRES mApple vector for overexpression experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-terminal KRAB-dCas9 (a gift from Bruce Conklin, Addgene plasmid # 73498) fused with a destabilising domain ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Neuroscience 2024Quote: ... or GCaMP8s (n = 7, pAAV1.Syn.GCaMP8s.WPRE, Addgene, titer order of magnitude 1012) was pressure ejected at 4 sites ∼200 μm below the dura (25 nl each ...
-
bioRxiv - Genomics 2024Quote: ... (pLEX_305-N-dTAG was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91797 ...
-
bioRxiv - Immunology 2021Quote: ... gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537; http://n2t.net/addgene:19537; RRID:Addgene_19537)(46 ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701; http://n2t.net/addgene:18702; RRID: Addgene_18701; a gift from Yu-Zhu Zhang [72]), that was digested with the same enzymes ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized plasmids encoding the individual His-tagged PBRM1 bromodomain constructs were received from Nicola Burgess-Brown (Addgene plasmid numbers 38999 ...
-
bioRxiv - Biophysics 2022Quote: ... GST-mCherry-FYVE (https://www.protocols.io/view/expression-and-purification-protocol-of-gst-mch-fy-b8k5ruy6) and His-TEV-ATG3 (Addgene_169079 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Biophysics 2024Quote: His-tagged TEV protease (pDZ2087, a gift from David Waugh (Addgene plasmid # 92414 ; http://n2t.net/addgene:92414 ; RRID:Addgene_92414)) was expressed in BL21(DE3)CodonPlus E ...
-
bioRxiv - Biochemistry 2024Quote: ... The construct for LbCas12a expression (pMAL-His-LbCpf1-EC) - a gift from Jin-Soo Kim (RRID: Addgene 79008) (Kim et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The correct clone was used as entry clone and then the cloned gene was shuttled to destination vector pLX301 (Addgene Plasmid #25895) For constitutive overexpression of either Alkbh5 or Alkbh5-HA ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Zoology 2023Quote: ... or a human TLR4 expression clone (Addgene, cat. #13018). Additionally ...
-
bioRxiv - Molecular Biology 2020Quote: ... into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138440). Full-length UL87 was PCR amplified from HCMV Towne BAC DNA with primers to introduced EcoRI and XhoI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid expressing the human ACE2 protein with a C-terminal C9 tag was obtained from Addgene (Plasmid 1786). 293T cells were transduced with retroviral particles carrying a pQCXIP vector encoding the gene for the human ACE2 protein ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465; http://n2t.net/addgene:32465; RRID:Addgene_32465), and (iv ...
-
bioRxiv - Developmental Biology 2020Quote: ... The 3x FLAG 2x Strep tag sequence was amplified from AAVS1 Puro Tet3G 3xFLAG Twin Strep (Addgene, # 92099) (Dalvai et al. ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Genetics 2022Quote: ... subcloned first in the pRK5 plasmid containing the GST tag sequence (Addgene, pRK5-HA GST RagC wt, #19304) at the N-terminal by using SalI and NotI restriction enzymes to replace RagC with PUM1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This receptor harbors a myc-tag on its extracellular domain that can be visualized by immunostaining (Addgene #79128). A second virion expresses both the mCherry reporter and BFP under control of the Tetracycline responsive element (TRE-3G ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplicons were subsequently combined with a level 0 C-terminal 6xHis tag module pICSL50025 (Addgene plasmid # 174589) and either pOPARA1 ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032; http://n2t.net/addgene:145032; RRID:Addgene_145032)60 ...
-
bioRxiv - Cell Biology 2023Quote: The α5 with C-terminal EGFP tag (α5-EGFP) was a gift from Rick Horwitz (Addgene plasmid #15238; http://n2t.net/addgene:15238; RRID:Addgene_15238) [46] ...
-
bioRxiv - Cell Biology 2023Quote: ... The α9 with C-terminal EGFP tag (α9-EGFP) was a gift from Dean Sheppard (Addgene plasmid #13600; http://n2t.net/addgene:13600; RRID:Addgene_13600). The α3 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074; http://n2t.net/addgene:24074; RRID:Addgene_24074). GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... the ADH1 terminator coupled to 3xHA tag was amplified from plasmid pFA6a-3HA-His3MX6-n9 (Addgene Reference #41600); PtSeipin coding sequence was amplified from the pPha-PtSeipin-eGFP previously obtained ...