-
No products found
because this supplier's products are not listed.
Thomas G.W. Graham, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and N,N’-Hexamethylene bis(acetamide) (HMBA; Sigma 224235) was used at a final concentration of 10 mM [sic] ...
-
No products found
because this supplier's products are not listed.
T Fuchsberger, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 10 µM N,N,H,-trimethyl-5-[(tricyclo[3.3.1.13,7]dec-1-ylmethyl)amino]-1- pentanaminiumbromide hydrobromide (IEM1460; Tocris Bioscience).
-
No products found
because this supplier's products are not listed.
Elynor Moore, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... containing 20 μL N,O- Bis(Trimethylsilyl)acetamide (Merck) and incubated for four hours at 50 °C and then briefly vortexed before direct injection into an Agilent Technologies (Palo Alto ...
-
No products found
because this supplier's products are not listed.
Nima Ahmadkhani, et al.,
bioRxiv - Bioengineering 2024
Quote:
... acetamide (Thermo Scientific Chemicals), 1,3-dihydroxyacetone (VWR) ...
-
No products found
because this supplier's products are not listed.
Christopher Chidley, et al.,
bioRxiv - Cancer Biology 2023
Quote:
(1S,3R)-RSL3 (Cayman Chemical 19288), Erastin (MedChemExpress HY–15763) ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
No products found
because this supplier's products are not listed.
Milou E. Noltes, et al.,
bioRxiv - Cell Biology 2022
Quote:
Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-(3-(cyclopentyloxy)-4-methoxyphenyl)pyrrolidin-2-one (rolipram; Abcam); 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62 ...
-
No products found
because this supplier's products are not listed.
Stephen E. Henrich, et al.,
bioRxiv - Microbiology 2020
Quote:
... a phospholipid--1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[3-(2-pyridyldithio)propionate] (PDP PE) (Avanti Polar Lipids)—was added to the suspension at a 250-fold molar excess to [AuNP] ...
-
No products found
because this supplier's products are not listed.
Stephanie M. Staszko, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male (n=3) and female (n=6) C57BL/6J mice (The Jackson Laboratory) were used for all miniscope experiments ...
-
No products found
because this supplier's products are not listed.
Yibin Lin,
bioRxiv - Biochemistry 2020
Quote:
3-(laurylamido)-N,N’-dimethylaminopropylamine oxide (LAPAO) and n-dodecyl beta-D - maltoside (DDM) were obtained from Anatrace. Ni-NTA resin was obtained from SIGMA® ...
-
No products found
because this supplier's products are not listed.
Meaghan H. Hancock, et al.,
bioRxiv - Microbiology 2020
Quote:
... Flt-3R (8F2, Cell Signaling), FOXO3a (Cell Signaling) ...
-
No products found
because this supplier's products are not listed.
Maxx Swoger, et al.,
bioRxiv - Biophysics 2024
Quote:
... and 3 μL of N,N,N°,N°-tetramethyl ethylenediamine (Bio-Rad) were added to initiate the acrylamide polymerization ...
-
No products found
because this supplier's products are not listed.
Tom Cremer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... 500µM N-(3-Aminopropyl)cyclohexylamine (APCHA, Santa Cruz Biotechnology), 50µM Diminazene aceturate (Dize ...
-
No products found
because this supplier's products are not listed.
Levi Arnold, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
No products found
because this supplier's products are not listed.
Bin Wang, Jay C. Dunlap,
bioRxiv - Biochemistry 2023
Quote:
... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
No products found
because this supplier's products are not listed.
Paul EC Mertens, et al.,
bioRxiv - Neuroscience 2021
Quote:
Experiments were performed on Lister Hooded rats (n=3, Envigo, the Netherlands) at an age between 9 and 40 weeks ...
-
No products found
because this supplier's products are not listed.
Gillian Dekkers, et al.,
bioRxiv - Immunology 2020
Quote:
... and 0.1 M 3-(N,N-dimethylamino) propyl-N-ethylcarbonadiimide (GE healthcare) at a flow rate of 5 µL/min ...
-
No products found
because this supplier's products are not listed.
Marco Cassani, et al.,
bioRxiv - Bioengineering 2024
Quote:
... N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide (EDC)-hydrochloride (59002, VWR); 4′,6-diamidine-2′-phenylindole dihydrochloride (10236276001 ...
-
No products found
because this supplier's products are not listed.
Lech Kaczmarczyk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used four individual samples (exceptions: SST RML 10 WPI: n = 3; PV NBH 10 WPI: n = 3; Astro RML 18 WPI: n = 2). RNA was converted to cDNA using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche Aplied Science) ...
-
No products found
because this supplier's products are not listed.
Jing Pei, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
No products found
because this supplier's products are not listed.
Congcong Xu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 5 µg of LPP formulated circRNA or linear RNA encoding Firefly Luciferase (FLuc) in PBS were administrated into mice (n=3 for each group) intramuscularly with 3/10 insulin syringes (BD biosciences). Mice were then anesthetized for whole-body bioluminescence imaging with an IVIS Spectrum (Roper Scientific ...
-
No products found
because this supplier's products are not listed.
Erika Pinheiro-Machado, et al.,
bioRxiv - Cell Biology 2024
Quote:
... HUVEC (n = 3) and RAEC (n = 3) were seeded onto growth factor-reduced Matrigel (Corning, Amsterdam, The Netherlands) in a 96-well plate at a density of 35,000 cells per well ...
-
No products found
because this supplier's products are not listed.
Yali Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... SARS-CoV2-S1 (Sino Biological, 40591-V08H, n=3) and SARS-CoV2-S2 (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Irrem-Laareb Mohammad, et al.,
bioRxiv - Biophysics 2022
Quote:
... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
No products found
because this supplier's products are not listed.
Michael Scheckenbach, et al.,
bioRxiv - Biophysics 2024
Quote:
... Measurements were performed in AC mode on a scan area of 3 x 3 µm with a micro cantilever (νres = 110 kHZ, kspring = 9 N/m, Olympus Corp.). Leveling ...
-
No products found
because this supplier's products are not listed.
A.R. Jeffries, et al.,
bioRxiv - Genomics 2020
Quote:
RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
No products found
because this supplier's products are not listed.
Atanu Maiti, Hiroshi Matsuo,
bioRxiv - Biochemistry 2024
Quote:
... 3’ BamHI) SARS-Cov-2 N gene (Gene ID: 43740575) in pET-11a vector without any affinity tag (GenScript). pET-11a expression vector carrying SARS-Cov-2 N gene was transformed in BL21 (DE3 ...
-
No products found
because this supplier's products are not listed.
Golam T. Saffi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
No products found
Deepak Kumar, et al.,
bioRxiv - Microbiology 2024
Quote:
... Jeg-3 cells in six well glass bottom plates (Cellvis, P06-1.5H-N) post-transfection were fixed with 4% paraformaldehyde at room temperature for 15 minutes ...
-
No products found
because this supplier's products are not listed.
M.V. Dziuba, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3D-SIM (striped illumination at 3 angles and 5 phases) was performed on an Eclipse Ti2-E N-SIM E fluorescence microscope (Nikon) equipped with a CFI SR Apo TIRF AC 100×H NA1.49 Oil objective lens ...
-
No products found
because this supplier's products are not listed.
Rebecca L. Ross, et al.,
bioRxiv - Immunology 2020
Quote:
... PerCPVio770-CD123 (IL-3R) and PE-CD304 (BDCA4) FITC-CD303 (BDCA2) (Miltenyi Biotec). The plate was then incubated at 4 C for 30 minutes followed by addition of 200ul of FACS buffer and centrifugation at 300g for 10 minutes at 4 C ...
-
No products found
because this supplier's products are not listed.
Greta Csalane Besenyei, et al.,
bioRxiv - Bioengineering 2024
Quote:
... N-(3-aminopropyl)methacrylamide hydrochloride (APMA) was obtained from Polysciences Inc (Warrington ...
-
No products found
because this supplier's products are not listed.
Lotfi Ferhat, et al.,
bioRxiv - Neuroscience 2024
Quote:
... were prepared from Sprague Dawley rats (n=3; 3-4 weeks old; Janvier Laboratories) and cut using a vibratome (Leica VT1200S) in an ice-cold oxygenated ...
-
No products found
because this supplier's products are not listed.
Inga E. Rødahl, et al.,
bioRxiv - Immunology 2024
Quote:
... intestine and skin (n = 3, PCW 9.5) were stained with the following antibodies (clone, fluorophore, company): CD3 (UCHT1, FITC, Biolegend), CD7 (M-T701 ...
-
No products found
because this supplier's products are not listed.
Mie Kobayashi-Ishihara, et al.,
bioRxiv - Immunology 2022
Quote:
... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
No products found
because this supplier's products are not listed.
S. Gulberk Ozcebe, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The relative expression levels of apoptosis related proteins of post I/RI iCMs (n=3) were analyzed using the Proteome Profiler Human Apoptosis Array (ARY009, R&D Systems), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Young-Eun Han, et al.,
bioRxiv - Neuroscience 2022
Quote:
... was performed over the vS1 of the mouse and covered with a double-layered round glass coverslip (3 mm: 64-0720 [CS-3R], Warner Instruments, Hamden, CT; 5 mm: Electron Microscopy Sciences, Hatfield, PA, 72195-05), bonded with an optical adhesive (NOA71 ...
-
No products found
because this supplier's products are not listed.
Andrea Mainardi, et al.,
bioRxiv - Bioengineering 2023
Quote:
Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
No products found
because this supplier's products are not listed.
Esther Wehrle, et al.,
bioRxiv - Bioengineering 2021
Quote:
... n=8) or collagen scaffolds+BMP-2 (2.5μg/scaffold; PeproTech, London, UK; n=8). Perioperative analgesia (25 mg/L ...
-
No products found
because this supplier's products are not listed.
Khyati Gohil, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The images of these droplets (n ≥ 3) were acquired with Metamorph software (Molecular Devices) with a 30-s interval and a 100-ms exposure time.
-
No products found
because this supplier's products are not listed.
Uzma Din, Sourav Banerjee, Soumya Iyengar,
bioRxiv - Neuroscience 2024
Quote:
... Area X (n = 4) and (ii) HVC (n = 3; [14]. The sections were rinsed in PBS, subjected to antigen retrieval (Vector Laboratories, H-3300, pH 6) and treated with 2N HCl ...
-
No products found
because this supplier's products are not listed.
Eugenio Graceffo, et al.,
bioRxiv - Genetics 2023
Quote:
... cerebral organoids were derived from hiPSC of n=3 healthy donors using the STEMdiff™ Cerebral Organoid Kit (StemCell Technologies, #08570, #08571) according to the manufacturer’s instructions and collected on days 21 ...
-
No products found
because this supplier's products are not listed.
Kevin D. Costa, et al.,
bioRxiv - Bioengineering 2024
Quote:
Frozen TGFb1/ET1-treated and untreated hvCTS (n=7 per condition) and hvCOC (n=5 per condition) were lysed using Agencourt RNAdvance Tissue kit (Beckman Coulter) lysis buffer and homogenized at 1000 rpm for 2 min with 5 mm Stainless Steel Beads (Qiagen ...
-
No products found
because this supplier's products are not listed.
Alex Rosenberg, L. David Sibley,
bioRxiv - Microbiology 2020
Quote:
... on Cytation 3 (BioTek) multimode plate imager according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... + 3% donkey serum (Jackson ImmunoResearch)] at room temperature for 15 mins ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Allen K. Kim, Helen D. Wu, Takanari Inoue,
bioRxiv - Cell Biology 2020
Quote:
... filter wheels (Lambda 10-3, Sutter Instruments), and LED light source (pE-300 ...