Labshake search
Citations for Bio-Rad :
1 - 50 of 582 citations for N 3R Pyrrolidin 3 ylmethyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... and 3 μL of N,N,N°,N°-tetramethyl ethylenediamine (Bio-Rad) were added to initiate the acrylamide polymerization ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... N,N,N’,N’-Tetramethylethylenediamine (TEMED, 1610801, Bio-Rad), Ammonium persulfate (APS ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.05% N,N,N’,N’-tetramethylethylenediamine (TEMED; Bio-Rad) was used to catalyze the reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... N,N,N′,N′-Tetramethylethylenediamine (TEMED) was sourced from Bio-Rad Laboratories.
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... n,n’-methylene-bis-acrylamide (BIORAD, 2% w/v stock solution), N-6-((acryloyl)amino)hexanoic acid crosslinker (N6 ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.035-0.25% N,N-methylenebisacrylamide crosslinker (Bis, 2% w/v stock, 161040, BioRad), 0.06% SDS (5% w/v stock in DI water ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.25% N,N′-methylene-bis-acrylamide (2% w/v solution, Bio-Rad) to tune gel stiffness to 8.6 kPa ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Bioengineering 2023Quote: ... 35 µL N,N-methylenebisacrylamide crosslinker (2% w/v bis-acrylamide Solution, 1610142, Bio-Rad), 20 µL of 1:100 diluted fluorescent beads in DI water (FluoSpheres carboxylate-modified 0.2 µm ...
-
bioRxiv - Bioengineering 2024Quote: ... 35 µL N,N-methylenebisacrylamide crosslinker (2% w/v bis-acrylamide Solution, 1610142, Bio-Rad), 20 µL of 1:100 diluted fluorescent beads in DI water (FluoSpheres carboxylate-modified 0.2 µm ...
-
bioRxiv - Biochemistry 2022Quote: ... stock solution of 40% neutral acrylamide and N,N’-methylenebisacrylamide in a 19:1 ratio (Bio-Rad) were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 hpf (n=40) or 48 hpf (n=25) embryos using the Aurum Total RNA Mini Kit (Bio-Rad). cDNA was then prepared with the RevertAid reverse transcriptase (Thermo Fisher) ...
-
bioRxiv - Biophysics 2023Quote: ... extracted agarose gel parts were divided by cutting several times and purified via Freeze N′ Squeeze columns (Freeze N′ Squeeze, 7326165, BioRad) according to the manufacturer’s instructions using a benchtop centrifuge (Biofuge fresco ...
-
bioRxiv - Microbiology 2022Quote: ... anti-Metapneumovirus N mouse monoclonal (1:25) (MCA4674, Bio-Rad), or anti-Influenza A nucleoprotein (NP ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... was purchased from G-Biosciences and Freeze ‘N Squeeze DNA gel extraction columns by Bio-rad, Inc ...
-
bioRxiv - Biophysics 2022Quote: ... which were subsequently used with Freeze ‘N Squeeze spin columns (BioRad).
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... final concentrations of 2X SsoADV Universal SYBR Green Supermix (BIORAD, n° 1725270) and 0.04μM of each primer ...
-
bioRxiv - Biophysics 2023Quote: ... and samples were extracted with Freeze N’ Squeeze spin columns (Bio-Rad) by centrifugation at 1,000 g for 60 minutes at 4 ºC ...
-
bioRxiv - Microbiology 2024Quote: ... blocked with Intercept™ (TBS) buffer (Bio-Rad, P/N: 927-70001) or 5% skim milk for 1 hour at room temperature and incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... crushed and structures were purified with Freeze ‘N Squeeze spin columns (Bio-Rad) for 5 min at 1,000×g at 4 °C.
-
bioRxiv - Biophysics 2020Quote: ... crushed and spun through a Freeze N’ Squeeze column (BioRad Sciences, 732-6165) for 3 min at 13,000g at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... Freeze ‘N Squeeze columns (catalog no. 732-6165) were obtained from Bio-Rad. Cy3b-maleimide (catalog no ...
-
bioRxiv - Immunology 2024Quote: ... filtered through Freeze ‘N Squeeze DNA Gel Extraction Spin Columns (Bio-Rad; #7326165) and purified via ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... filtering through Freeze ‘N Squeeze DNA Gel Extraction Spin Columns (Bio-Rad; #7326165) and then finally performing ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... filtering through Freeze ‘N Squeeze DNA Gel Extraction Spin Columns (Bio-Rad; #7326165) and then using ethanol precipitation ...
-
bioRxiv - Neuroscience 2022Quote: ... proteins were transferred onto a 0.45 μm nitrocellulose membrane (Bio-Rad, catalog n° 1620115) for 1 hour at RT at 100V ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples for AFM imaging were purified by using the Freeze ‘N Squeeze kit (BioRad) according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2024Quote: ... The samples were purified for TEM imaging using the Freeze ’N Squeeze (Bio-Rad) gel extraction column and imaging samples were prepared as previously described.
-
bioRxiv - Plant Biology 2022Quote: ... Images were taken by ChemiDoc™ MP Imaging System (Bio-Rad, Catalog N° #12003154).
-
bioRxiv - Bioengineering 2023Quote: ... Purification of DNA origami structures was performed by gel extraction (Freeze ‘N Squeeze, BioRad) or PEG precipitation (46) ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mononucleosomal DNA was purified using agarose gel electrophoresis and Freeze N’ Squeeze Columns (BioRad, #7326166). As a spike-in control ...
-
bioRxiv - Molecular Biology 2021Quote: Purified SARS-CoV-2 N protein was electrophoresed on 4-10% SDS-PAGE (Bio-Rad) and stained with Coomassie Brilliant Blue G-250 (CBBG-250) ...
-
bioRxiv - Microbiology 2020Quote: ... and transferred to Hybond N+ (Amersham Biosciences) membrane using a Trans-Blot Turbo system (Biorad). A denaturated DNA marker was used for size estimation.
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...