Labshake search
Citations for New England Biolabs :
1 - 50 of 1472 citations for N 3R Pyrrolidin 3 ylmethyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was isolated from frozen hDRG tissue and GBP- or vehicle-treated primary hDRG cultures (n = 3 per condition) using the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Immunology 2024Quote: ... and β-N-Acetylglucosaminidase S (NEB), or all three enzymes were performed overnight at 37 °C using 1 unit each of enzyme ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and de-N-glycosylated using 500 U N-glycosidase F (PNGase F, New England Biolabs) for 12 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... N-glycans were released using N-glycanase PNGase F (1239U/ml, New England BioLabs, Inc. cat no. P0709L) and were fluorescently labelled with 2-aminobenzamide (2-AB ...
-
bioRxiv - Bioengineering 2022Quote: ... or 1 μg Asp-N (NEB, England) for overnight digestion respectively ...
-
bioRxiv - Immunology 2020Quote: ... deglycosylated with N-glycanase (New England Biolabs), and digested overnight with LysC protease (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... or N-glycosilase F (PNGaseF, NEB P0704S), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... endoproteinase Asp-N (New England Biolabs, #P8104S), Glu-C (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Trypsin digest of PDI was followed by digestion of N-glycans with endo-β-N-acetylglucosaminidase H (500 U; NEB) in sodium citrate buffer (50 mm ...
-
bioRxiv - Microbiology 2024Quote: Codon-optimized full-length SARS-CoV-2 S protein gene was cloned into Topo cloning vector and 22 N-glycosylation sites were mutated individually from N to Q using a Q5 Site-Directed Mutagenesis Kit (NEB). The full-length or C19 truncated fragments were amplified and inserted into plvx-puro vector ...
-
bioRxiv - Microbiology 2022Quote: ... Peptide-N-Glycosidase F (PNGase F; NEB, P0704) treatment of lysates was performed as described in the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli BL21 lysY/Iq (NEB cat n° C3013). The expression plasmid was transformed via heat-shock followed by selection of clones on LB-Agar plates supplemented with 100 µg/mL carbenicillin ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were amplified for N-1 cycles (being N the optimum Cq determined by qPCR reaction) using NEBNext High-Fidelity Polymerase (New England Biolabs, M0541). Libraries were purified with Sera-Mag Select Beads (GE Healthcare ...
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Microbiology 2024Quote: SARS-CoV-2 N (nucleocapsid) protein qPCR system (IDT, Iowa City, IA) and RSV N qRT-PCR (Luna, NEB, Ipswich, MA) were detected under one-step qRT-PCR on a QuantStudio 3 (Applied Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... the pHAGE lentiviral plasmid encoding SARS-CoV-2 N-LgBIT and N-SmBIT were generated by NEBuilder HiFi DNA Assembly (New England Biolabs E2621S). Oligonucleotide primers were obtained from Azenta Life Sciences ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide-N-glycosidase F (PNGase F) (New England BioLabs) was used to remove all N-linked oligosaccharides for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... as N-terminal VP16 fusions using HiFi assembly (NEB). The human ERG ETS domain ...
-
bioRxiv - Microbiology 2022Quote: ... or for peptide N-glycosidase F (PNGase-F, NEB) digestion using 500 units PNGase-F for 1,5h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... the sample was deglycosylated with N-glycosidase F (Biolabs) and Sialidase A (Prozyme ...
-
bioRxiv - Biochemistry 2023Quote: ... N-glycans were released with PNGase F (NEB, P0709) for 20 h at 37 °C and the released N-glycans were isolated by passage through a pre-washed 10 kDa MWCO filter ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein/lysate sample de-N-glycosylation using PNGase F (NEB), Endo S (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The N expression plasmid was linearized using EcoRV-HF (NEB). Capped-RNA was produced using the mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... or peptide N-glycanase (PNGase, New England Biolabs, 1,000 units) for 6 h ...
-
bioRxiv - Microbiology 2022Quote: ... N-glycans were isolated by treatment with PNGase F (NEB) under denaturing conditions followed by solid phase extraction purification ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of peptide N-glycosidase F (New England Biolabs) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... the N-glycans were released using peptide:N-glycosidase F (NEB, in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2024Quote: ... the sample was de-glycosylated with N- glycosidase F (Biolabs) and Sialidase A (Prozyme ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... and digested with 200U DpnII (New England Biolabs, Cat. N: R0543) overnight at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... BbvCI (cat. n° R0601L, NEB, New England Biolabs, Ipswich, MA, USA), to obtain the linearized plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... glycerol-free peptidyl-N-glycosidase F (PNGase F) (New England Biolabs), Endoglycosidase Hf (Endo Hf ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...
-
bioRxiv - Immunology 2021Quote: ... BbvCI (cat. n° R0601L, NEB, New England Biolabs, Ipswich, MA, USA), to obtain the linearized plasmid ...