-
No products found
because this supplier's products are not listed.
Jian Wu, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Z-Arg-Leu-Arg-Gly-Gly-AMC (Bachem Bioscience), and its activity was continuously monitored at 360 nm (excitation ...
-
No products found
because this supplier's products are not listed.
Arundhasa Chandrabalan, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
James L. J. Coleman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Verification of TIMP activity in vitro using activated MMP-2 and the fluorogenic peptide substrate MCA-Pro-Leu-Gly-Leu-DPA-Ala-Arg-NH2 was performed as per the protocol provided by R&D Systems.
-
No products found
because this supplier's products are not listed.
Fushun Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Thr-Phe-Leu-Leu-Arg-NH2 (TFLLR-NH2, 30 µM, Tocris); N-Acetyl-Asp-Glu (NAAG ...
-
No products found
because this supplier's products are not listed.
Alexander Kapustin, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Peptides were Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP, Merck, SCP0157) and scramble control Gly-Arg-Ala-Asp-Ser-Pro (GRADSP ...
-
No products found
because this supplier's products are not listed.
Virja Mehta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... SILAC media was prepared by supplementing high glucose DMEM minus Arg/Lys/Leu/Met (AthenaES) with 10% dialyzed FBS (ThermoFisher) and the appropriate amino acids ...
-
No products found
because this supplier's products are not listed.
Brian G. Peterson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... coupled to a Gly-Gly-Gly-Cys peptide (Genscript). The next morning ...
-
No products found
because this supplier's products are not listed.
David Guérit, et al.,
bioRxiv - Cell Biology 2020
Quote:
... L amino acids were substituted for the same concentrations of heavy isotope–labeled (H) amino acids 13C6-15N2 L-Lys:2HCl and 13C6-15N4 L-Arg (Cambridge Isotope Laboratories). For immature dendritic cells (Dc ...
-
No products found
because this supplier's products are not listed.
Laura Alejandra Ariza Orellano, et al.,
bioRxiv - Immunology 2024
Quote:
... were quantified using AMC-based fluorogenic substrates (Z-Leu-Arg-AMC, R&D Systems, for hCatL and Gly-Arg-AMC, Cayman Chemical Company, for mCatC). For the mCatC assay ...
-
No products found
because this supplier's products are not listed.
Nikolay S. Ilyinsky, et al.,
bioRxiv - Cell Biology 2023
Quote:
Magic Red (Arg-Arg-Cresyl Violet-Arg-Arg) (Abcam), fluoregenic substrate ...
-
No products found
because this supplier's products are not listed.
Deding Su, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Culture mediums SD/-Leu/-Trp and SD/-Ade/-His/-Leu/-Trp (Clontech, USA) with or without X-α-gal were used to select the positive transformants.
-
No products found
because this supplier's products are not listed.
Jordy Evan Sulaiman, et al.,
bioRxiv - Systems Biology 2024
Quote:
... and OD600 was measured every 3 h (Tecan Infinite Pro F200).
-
No products found
because this supplier's products are not listed.
Elany Barbosa da Silva, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Mca-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu- Lys(DNP)-dArg-NH2 (shortened to GKPILFFRL) (CPC Scientific) using a Synergy HTX (Biotek) fluorimeter ...
-
No products found
because this supplier's products are not listed.
Arundhasa Chandrabalan, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Suc-Ala-Ala-Pro-Phe-AMC (Chymotrypsin substrate II) and Z-Gly-Gly-Arg-AMC.HCl (Urokinase substrate III) were from Calbiochem, and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6 ...
-
No products found
because this supplier's products are not listed.
Tigist Y. Tamir, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... including flexible Gly-Ser-Ser-Gly linkers between NL and BRSK2 (Promega). For cellular BRSK2 NanoBRET target engagement experiments ...
-
No products found
because this supplier's products are not listed.
Jan Knoblauch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
No products found
because this supplier's products are not listed.
Claire Gibson, et al.,
bioRxiv - Microbiology 2023
Quote:
... ARGs were amplified using a multiplex PCR kit (Qiagen) with the following reaction conditions ...
-
No products found
because this supplier's products are not listed.
Melia Matthews, et al.,
bioRxiv - Bioengineering 2023
Quote:
... containing the sequence cyclo-(Arg-Gly-Asp-Tyr) were conjugated to a heterobifunctional PEG-silane with a maleimido group through cysteine-maleimide linkage (Santa Cruz Biotechnology). This cRGDyC-PEG-silane was then added during the PEGylation step along with the unmodified PEG-silane (Gelest) ...
-
No products found
because this supplier's products are not listed.
Xinquan Zhang, et al.,
bioRxiv - Microbiology 2023
Quote:
... Metabolites were separated on a Luna 3 μm NH2 100 NH2 100Å (150 x 2.0 mm) column (Phenomenex). The flow rate was 0.3 mL/min ...
-
No products found
because this supplier's products are not listed.
Evelyn Tran, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Citrate-based unmasking solution was used for pro-SPC probed samples (Vector Laboratories H-3300). Primary antibodies were diluted in 5% BSA-PBS or 30% horse serum (pro-SPC antibody ...
-
No products found
because this supplier's products are not listed.
Elena Winheim, et al.,
bioRxiv - Immunology 2024
Quote:
Cytokine concentrations were measured in plasma samples using three panels (pro Human Cytokine, pro Human Chemokine, pro Human Inflammation) of the Bio-Plex Multiplex Assay (Bio-Rad Laboratories, USA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Richard C. Chang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... using SoftMax Pro (Molecular Devices) [13].
-
No products found
because this supplier's products are not listed.
Gianmatteo Vit, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PP2AC Methyl (Leu 309) (#828801, 1:3000, BioLegend), actin ...
-
No products found
because this supplier's products are not listed.
Ralf D. Ottofuelling, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 8.75 µM [14C]-Phe/Leu (18.3 GBq/mmol (PerkinElmer), 38.5 U E ...
-
No products found
because this supplier's products are not listed.
Glenn F. W. Walpole, et al.,
bioRxiv - Cell Biology 2021
Quote:
SopB and the inactive version were cloned into pESC-LEU (Agilent Technologies) for galactose inducible expression.
-
No products found
because this supplier's products are not listed.
Devendra Shivhare, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the mixed culture was inoculated in SC–Leu (selection for BD plasmid only), SC-Leu+FOA (to remove AAs) ...
-
No products found
because this supplier's products are not listed.
Ashley M. Otero, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and Mastercycler Pro Thermal Cycler (Eppendorf) and was subsequently diluted 1:5 in DEPC water ...
-
No products found
because this supplier's products are not listed.
Hirokazu Sakamoto, et al.,
bioRxiv - Neuroscience 2022
Quote:
... highly cross- adsorbed Donkey Anti-Rabbit IgG (H) and Donkey Anti-Guinea pig IgG (H) (Jackson ImmunoResearch) were used ...
-
No products found
because this supplier's products are not listed.
Shruthi Shanmukha, et al.,
bioRxiv - Immunology 2024
Quote:
... or arginase-1 (Arg-1; Cell Signaling Technology, 93668), followed by incubation with horseradish peroxidase (HRP ...
-
No products found
because this supplier's products are not listed.
Per Nilsson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 μM benzyloxycarbonyl (Z)-Leu-Leu-Leucinal (protease inhibitor, synthesized in-house) and Complete EDTA-free Protease Inhibitor (Roche, cat# 05056489001) in 50 mm MES pH 6.5 with or without 10 μM thiorphan (neprilysin-specific inhibitor ...
-
No products found
because this supplier's products are not listed.
Maya Hiltpold, et al.,
bioRxiv - Genetics 2021
Quote:
... Pro+ microwave system (Ted Pella, USA). Following the microwave-assisted fixation and dehydration procedure ...
-
No products found
because this supplier's products are not listed.
Marissa Jeme Andersen, et al.,
bioRxiv - Microbiology 2021
Quote:
... Zen Pro (Carl Zeiss, Thornwood, NY) and ImageJ software were used to analyze the images.
-
No products found
because this supplier's products are not listed.
Jérémy Guillot, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... using Imspector Pro software (Miltenyi Biotec). 3D volume images were generated using Imaris x64 software (version 9.2.1 and 9.3.0 ...
-
No products found
because this supplier's products are not listed.
Marième Ndjim, et al.,
bioRxiv - Immunology 2023
Quote:
... with Q-Capture Pro software (Nikon). Stained slides were also imaged with the Nanozoomer device (Hamamatsu) ...
-
No products found
because this supplier's products are not listed.
Mary Ann Checkley, et al.,
bioRxiv - Immunology 2022
Quote:
... and SoftWoRX Pro 6.5.1 software(Applied Precision).
-
No products found
because this supplier's products are not listed.
Jesslyn E. Park, et al.,
bioRxiv - Molecular Biology 2023
Quote:
tRNA-Tyr and tRNA-Val probes were labeled with IRDye800RD and the tRNA-Gly probe was labeled with IRDye680RD (LI-COR), respectively ...
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
... CldU- or IdU-labeled cells expressing Zif268 (one side) were determined using a confocal microscope with HeNe and Arg lasers (Leica, DMR TCSSP2AOBS), with a plane apochromatic 63X oil lens (numerical aperture 1.4 ...
-
No products found
because this supplier's products are not listed.
Parameshwar Jakinala, et al.,
bioRxiv - Microbiology 2020
Quote:
... 150 V (DelsaMax PRO Light Scattering Analyzer, Beckman Coulter, United States) in distilled water ...
-
No products found
because this supplier's products are not listed.
Britney Sekulovski, Noam Miller,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... AVT ([Arg⁸]-Vasotocin, VWR International), an IT antagonist (L-368,899 hydrochloride ...
-
No products found
because this supplier's products are not listed.
Stephen D. Carter, et al.,
bioRxiv - Cell Biology 2021
Quote:
... gold Quantifoil London finder grids (EMS R2/2 LF-Au-NH2) were UV treated to sterilize and coated with cell adhesion matrix ...
-
No products found
because this supplier's products are not listed.
Tiffany Ge, et al.,
bioRxiv - Cell Biology 2024
Quote:
... pTG023 was constructed using PCR amplification of Plas-gRNA-LEU (Addgene #309094), a gBlock designed to fuse csGBP-mAID (IDT ...
-
No products found
because this supplier's products are not listed.
Gabriele Chelini, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 1 to 1000 dilution of primary antibody (Rabbit anti-Arc/Arg 3.1, Proteintech - Cat.16290-1-AP)] and incubated at room temperature for 24 hr ...
-
No products found
because this supplier's products are not listed.
Xinhui Xu, et al.,
bioRxiv - Biochemistry 2020
Quote:
An amino-modified oligo RE-NH2 (Table S3) was covalently coupled to the DNA-BIND 96-well microplate (Corning) according to the instructions of manufacturer to prepare the oligo-coated microplate ...
-
No products found
because this supplier's products are not listed.
Claudia Parada, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Images were acquired using Xcellence Pro software (Olympus Corp., Tokyo, Japan) with an X-Cite® 120 Metal Halide lamp (Excelitas Technologies Corp. ...
-
No products found
because this supplier's products are not listed.
Simone Caielli, et al.,
bioRxiv - Immunology 2023
Quote:
... 5µM H-151 (Invivogen) or 50 nM Bafilomycin A1 (Invivogen) ...
-
No products found
because this supplier's products are not listed.
Nina Schweizer, et al.,
bioRxiv - Cell Biology 2020
Quote:
... CDB1354K (http://www2.clst.riken.jp/arg/mutant%20mice%20list.html) with B6.Tg(Actl6b-Cre)4092Jiwu/J mice (Jackson Laboratories). Mouse strains were maintained on a mixed C57BL/6 background in strict accordance with the European Community (2010/63/UE ...
-
No products found
because this supplier's products are not listed.
Esther A. Mozipo, et al.,
bioRxiv - Bioengineering 2023
Quote:
MODDE-Pro 13.0 software (Sartorius, Fremont, CA) was used to generate the D-optimal experimental matrix of 15 hydrogel formulations and analyze the experimental data obtained ...
-
No products found
because this supplier's products are not listed.
Omri Zveik, et al.,
bioRxiv - Immunology 2023
Quote:
... Pro-inflammatory IFNγ(Cat#315-05,PeproTech, 10ng/mL) and TNFα (Cat#315-01A,PeproTech,200ng/mL) ...
-
No products found
because this supplier's products are not listed.
Lijie Shi, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Donkey anti-Rat IgG(H+L) AF555 (Southern Biotech #643032) and Donkey anti-Rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Kevin D. Whitley, et al.,
bioRxiv - Microbiology 2023
Quote:
... Growth was monitored for 15 h using a FLUOStar OPTIMA plate reader (BMG Labtech). Growth curves for each condition were performed in triplicate.