Labshake search
Citations for New England Biolabs :
1 - 50 of 519 citations for H Leu arg pro gly nh2 2hcl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Biophysics 2021Quote: ... was reacted with BG-NH2 (New England Biolabs) to produce the benzylguanine functionalised dye BG-CF640R ...
-
bioRxiv - Cell Biology 2023Quote: ... and BG-NH2 (New England Biolabs Inc., S9148S) (36 ...
-
bioRxiv - Cell Biology 2020Quote: BG-NH2 (New England Biolabs Inc., Ipswich, MA, USA) and NHS-Rho14 (ATTO-TEC GmbH ...
-
bioRxiv - Microbiology 2023Quote: ... a custom 3’ adapter (5ʹ-rAppCTGTAGGCACCATCAAT–NH2-3ʹ, NEB) was ligated to all RNAs following the protocol described in (91) ...
-
bioRxiv - Biophysics 2024Quote: ... 650 µM of BG-NH2 (New England Biolabs, S9148) was added to the mixture ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Systems Biology 2024Quote: ... and E.coli DH10B (NEB Labs, Catalog Number C3019H: Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 galE15 e14-ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (StrR ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Genetics 2020Quote: ... the Trp 185 residue was changed to Arg using Q5 Quick Mutagenesis Kit (NEB #E0552) according to the manufacturer’s instructions
-
bioRxiv - Molecular Biology 2022Quote: ... and tRNA-Gly-CCC (Table S1) were radioactively labeled with gamma-32P-ATP using T4 PNK (NEB). Pre-hybridization and hybridization were performed in OligoHyb Buffer (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... A preadenylated universal linker (5’-rAppCTGTAGGCACCATCAAT-NH2-3’) was prepared in house or purchased from NEB (S1315S) and ligated to the 3’ ends of the dephosphorylated footprints using T4 RNA Ligase 2 ...
-
bioRxiv - Cell Biology 2020Quote: Endoglycosidase H (endo H; BioLabs), peptide-N-glycosidase F (PNGase F ...
-
bioRxiv - Microbiology 2020Quote: ... sfgfp was cloned in-frame with tssB and a short linker (encoding 3×Ala 3×Gly) by Gibson Assembly (New England Biolabs) into pNCC1-Spec to allow IPTG-inducible expression of TssB-sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... Endoglycosidase H (Endo H, NEB P0702S) (500 U ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Table S2.1) for hydrogel functionalisation were synthesised by mixing one volume of 40 mM BG-PEG-NH2 (NEB S9150S) or 40 mM chloroalkane-PEG-NH2 (Promega P6741 ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Immunology 2021Quote: ... endonuclease H (Endo H, New England Biolabs) was added to the samples after reduction and denaturation ...
-
bioRxiv - Physiology 2020Quote: ... Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554). Adeno-associated viruses (AAV ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... For endoglycosidase H (Endo H; P0702S, NE BioLabs) digestion experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... & H (NEB) for 30 minutes at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Biochemistry 2022Quote: ... thermophilus RNase H (Thermostable RNase H, New England Biolabs) at a final concentration of 5 U/μL at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Endoglycosidase H (endo H) (New England Biolabs, catalog #: P0703L) enzyme digestion or Peptide-N-Glycosidase F (PNGase F ...
-
bioRxiv - Microbiology 2020Quote: ... Endo H controls: Cells were treated with Endo H (NEB, 1:10 in glycobuffer 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... or with Endoglycosidase H (Endo H, New England Biolabs, P0702), with a2-3,6,8,9 Neuraminidase A (neuraminidase ...
-
bioRxiv - Microbiology 2020Quote: ... RNase H (NEB), in a total volume of 80µL ...
-
bioRxiv - Cell Biology 2022Quote: ... RNase H (NEB) and dUTP Solution (Thermo Fisher) ...
-
bioRxiv - Genetics 2021Quote: ... RNase H (NEB) and a dUTP solution (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... RNAse H (NEB) was added to remove RNA and samples were incubated at 37°C for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... RNAse H (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... RNAse H (NEB)) ...
-
bioRxiv - Immunology 2024Quote: Mab deglycosylation was performed with Endoglycosidase H (Endo H, NEB #P0702) and Endoglycosidase S (Endo S ...
-
bioRxiv - Microbiology 2021Quote: ... cell lysates were treated with endoglycosidase H (Endo H) (New England BioLabs) for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were subjected to RNase H (15U/well) or RNase H (NEB) buffer only treatment for 4 hr and RNase III or RNase III buffer (Ambion ...
-
bioRxiv - Microbiology 2024Quote: Cell lysates were digested for 1 h with Endo H (P0702, NEB) or PNGase F (P0704 ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Ribonuclease H (NEB) or ddH2O in 1xRibonuclease H buffer (2 h ...
-
bioRxiv - Molecular Biology 2020Quote: The Endo-H (NEB) and PNGase-F (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli RNase H (NEB) for two hours at 37 °C before spotting ...
-
bioRxiv - Cell Biology 2023Quote: ... Endo H (NEB, P0703L); Pierce ECLplus reagent (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... After RNase H (NEB) treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... and endoglycosidase H (NEB) digestion were performed as previously described (65 ...
-
bioRxiv - Genetics 2022Quote: ... Rnase H (NEB, M0297) and DNA polymerase I (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Targeted RNase H (NEB) digestions were performed according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... RNase H (NEB, M0297S) and DNase I (from bovine pancreas ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNase H (NEB, cat.m0297), and dUTP Solution (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... RNase H (NEB, m0297) and dUTP Solution (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: Salivary samples were additionally treated with Endoglycosidase H (Endo H; New England Biolabs), which cleaves the chitobiose core of high-mannose and some hybrid N-linked glycans [21] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 μL of 1X RNase H Buffer and 5μL of RNase H (NEB) were added to the beads and incubated at 37°C for 30 minutes while nutating ...