-
No products found
because this supplier's products are not listed.
Jieqiong Qu, et al.,
bioRxiv - Microbiology 2023
Quote:
... CHIKV virus stock (5 × 108 TCID50/mL) and full human blood (Sanquin) was 1:2 mixed to make the infectious blood meal with a final virus titer of 1.7× 108 TCID50/ml ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... human recombinant GST-fusion ERK3 protein (SignalChem) and E.coli purified ARP3 ...
-
No products found
because this supplier's products are not listed.
Felix Pahmeier, et al.,
bioRxiv - Microbiology 2020
Quote:
Huh7-Lunet-T7 cells expressing the dengue reporter constructs (Lunet-T7-RC) were seeded onto a glass bottom 35 cm2 dish (Mattek) at a density of 2 × 104 ...
-
No products found
because this supplier's products are not listed.
Young Bong Choi, et al.,
bioRxiv - Immunology 2021
Quote:
Purified recombinant human TAX1BP1 protein (catalog # P01; Abnova) was incubated with purified GST-tagged IKKi (catalog # PV4875 ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Purified human complement proteins (4 µg/mL, Complement Technology) were immobilized and were treated with His-tagged recombinant neuronal pentraxin proteins (4 µg/mL ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Julianne B. Riggs, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were subjected to Fc receptor blocking using Fc Shield (Tonbo Biosciences) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Manuel Bernabé-García, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and TAG-6 (Calbiochem, #581004) were added to 20 µM and 2.5 µM final concentration in cell culture ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Jessica M. Salmon, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Spleens were collected into RPMI 1640 containing 2% fetal calf serum (FCS) and dissociated with a scalpel and type 3 collagenase (Worthington) and DNAse I ...
-
No products found
because this supplier's products are not listed.
Joshua J. Sims, et al.,
bioRxiv - Genetics 2021
Quote:
... We measured reporter virus transduction activity on a luminometer (BioTek) using the Renilla Glo Kit (Promega ...
-
No products found
because this supplier's products are not listed.
Komal Raj Rijal, et al.,
bioRxiv - Microbiology 2020
Quote:
... The data presented in this study represents serological diagnosis using rapid test kit (SD Bioline dengue IgG/IgM antibody up to 2015; and after 2015, SD Bioline dengue duo (dengue NS1 Ag+ IgG/IgM), Korea ...
-
No products found
because this supplier's products are not listed.
Simon J. Cleary, et al.,
bioRxiv - Immunology 2024
Quote:
... These sequences were codon-optimized and antibodies were expressed as chimeric hIgG1 with or without Fc point mutations in a HEK293 cell system and purified using protein A and buffer exchange (Absolute Antibody).
-
No products found
because this supplier's products are not listed.
Paola Munoz-Tello, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... using a pET-46 tobacco etch virus (TEV) protease-cleavable N-terminal hexahistidine tag fusion protein in M9 media supplemented with 15NH4Cl (Cambridge Isotope Labs, Inc.). Nurr1 LBD was eluted against a 500 mM imidazole gradient through a Ni-NTA column ...
-
No products found
because this supplier's products are not listed.
Justine Creff, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 200 µg for HEK293) were incubated with 3 µg of the indicated antibodies and 12 µL protein sepharose beads (IPA300, Repligen) at 4°C for 4 h ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Tao Jing, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Viruses were generated by co-transfecting 107 cells plated the previous day in 15 cm dishes with 30 µg of total plasmid DNA (pNLX.Luc.R-.ΔAvrII and a vesicular stomatitis virus G envelope expressor at 6:1 ratio using PolyJet™ DNA transfection reagent; SignaGen Laboratories). Two days post-transfection ...
-
No products found
J.A. McPhail, et al.,
bioRxiv - Biochemistry 2019
Quote:
... HEK293-AT1 cells (3×105 cells/well) were plated on 29 mm circular glass-bottom culture dishes (#1.5; Cellvis) pre-coated with 0.01% poly-L-lysine solution (Sigma) ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Fc receptors were blocked for 30 min with Protein A (MP Biomedicals, OH) in Stain Buffer (554656 ...
-
No products found
because this supplier's products are not listed.
Arash Khorrami Jahromi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... human coronavirus (HCoV-229E) spike protein (RDC3141; Cedarlane), Middle East respiratory syndrome coronavirus (MERS-CoV ...
-
No products found
because this supplier's products are not listed.
Esther A. Mozipo, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Recombinant human bone morphogenetic protein-2 (BMP-2) and the human BMP-2 DuoSet enzyme-linked immunosorbent assay (ELISA ...
-
No products found
because this supplier's products are not listed.
Patrik Risteski, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and human anti-centromere protein antibody (Antibodies Incorporated). The secondary antibodies used were donkey anti-mouse IgG-Alexa Fluor 488 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Nathalie Lecat-Guillet, et al.,
bioRxiv - Biophysics 2022
Quote:
The pcDNA plasmid encoding human mGlu2 with N-terminal FLAG- and SNAP-tags was a gift from Cisbio Bioassays (Perking Elmer ...
-
No products found
because this supplier's products are not listed.
Chunru Wei, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The eluted proteins were subjected to immunoblot analysis with anti-FLAG tag polyclonal antibody (Solarbio, China). The detailed Co-IP was performed as described by Zhu and Huq [28].
-
No products found
because this supplier's products are not listed.
Juan Jauregui-Lozano, et al.,
bioRxiv - Genomics 2021
Quote:
CUT&Tag was performed using CUTANA™ CUT&Tag reagents (Epicypher, Durham NC ...
-
No products found
because this supplier's products are not listed.
Gabrielle L. Turvey, et al.,
bioRxiv - Cell Biology 2023
Quote:
... At 48 h post-transfection the supernatant containing virus was harvested and filtered through a low-protein binding filter (0.45µm, Sarstedt) to remove HEK debris ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Julian A. Harris, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A single bicistronic baculovirus encoding the human Gβ1 subunit with a N-terminal 6x His-tag and rhinovirus 3C protease site and untagged human Gγ2 subunit was generated using the BestBac method (Expression systems) in Spodoptera frugiperda (Sf9 ...
-
No products found
because this supplier's products are not listed.
Maria Rojec, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Cell envelopes were disrupted using a Bioruptor Plus sonication system (Diagenode s.a., Belgium) for 10 cycles ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
SEC-purified protein [in SEC buffer containing 3 mM DM (Anatrace)] was reconstituted into liposomes ...
-
No products found
because this supplier's products are not listed.
Farès Ousalem, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein samples were injected onto a Yarra 3 µm SEC-2000 (Phenomenex) running at room temperature in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Victoria L. Corbit, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Virus was injected using a syringe pump (Harvard Apparatus) fitted with a syringe (Hamilton ...
-
No products found
because this supplier's products are not listed.
Noémie Aurine, et al.,
bioRxiv - Cell Biology 2019
Quote:
... or universal IFN-type (a recombinant human IFN-alpha protein hybrid; Pbl Assay Science, 11200-2). Bat cells seeded in 12-well plates at 80% confluence were treated for 6 h at 37°C with either poly IC (0–1000 ng/mL ...
-
No products found
because this supplier's products are not listed.
Ashley A. Johnson, et al.,
bioRxiv - Physiology 2021
Quote:
... Spectra were measured from HEK293 cells using a 60x objective with NA 1.45 (Nikon) and an inverted microscope (Nikon TE-2000) ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Danila Boytsov, et al.,
bioRxiv - Biophysics 2022
Quote:
... the FCS unit (Confocor3, Carl Zeiss, Jena, Germany) of a commercial laser scanning microscope (LSM 510 ...
-
No products found
because this supplier's products are not listed.
Sergio Passarella, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 0,2 µM 5/6 TAMRA-PEG4-Alkyne tag (Jena Biosciences) and 0,2 mM freshly prepared CuSO4 ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... and given autoclaved water and a 3:1 mixture by volume of 14% protein mouse chow (Teklad Global 2014, Envigo) and black-oil sunflower seeds (Pennington Seed Inc. ...
-
No products found
because this supplier's products are not listed.
JF Sturgill, et al.,
bioRxiv - Neuroscience 2020
Quote:
... AAV virus (300nL volume) was then pressure injected 100nL/min via a glass pipette pulled (P-97 Sutter Instruments) from borosilicate capillaries (Drummond calibrated 5ul ...
-
No products found
because this supplier's products are not listed.
Yuanzhong Zhang, et al.,
bioRxiv - Biophysics 2023
Quote:
... SARS-CoV-2 envelope protein antibody (ProSci; 9169; 1:1000), SARS-CoV-2 Nucleocapsid protein (RayBiotech ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Jason Neidleman, et al.,
bioRxiv - Immunology 2020
Quote:
... or Influenza Virus Control Peptide Pool (Anaspec). As a positive control for cytokine detection ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Fc receptor blocker (Innovex Biosciences), and finally avidin/biotin blocking buffer (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Krishnakanth Kondabolu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... guinea pig anti-neuronal nuclei protein (NeuN, also known as hexaribonucleotide-binding protein 3; 1:500, 266004, Synaptic Systems, RRID:AB_2619988); goat anti-nitric oxide synthase (NOS ...
-
No products found
because this supplier's products are not listed.
Sarah J. Jefferson, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The mouse was briefly anesthetized with isofluorane and the magnetic ear tag was placed on a mouse’s ear using the ear tag applicator (#56791 Stoelting). Each mouse received one ear tag because signal was sufficiently strong with one tag and ears tended to get stuck together when both received ear tags ...
-
No products found
because this supplier's products are not listed.
Hanna Jérôme, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
No products found
because this supplier's products are not listed.
Marion Thépaut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Proteins were detected using InstantBlue protein stain (Expedeon) according to the supplier’s instructions.