-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Can Tan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cleared with FocusClear (CelExplorer Labs #FC-101) and mounted on slides in mounting medium.
-
No products found
because this supplier's products are not listed.
Meropi Aravantinou, et al.,
bioRxiv - Immunology 2020
Quote:
... Virus titer was determined in CEMx174 cells (ATCC, Manassass, VA) by p27 ELISA quantification (ZeptoMetrix, Buffalo, NY) and syncytia scoring after 14 days with the calculation method of Reed and Meunch ...
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Keiko Masuda, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
Non-labeled quantification tags were synthesized by Fluorenylmethyloxycarbonyl (Fmoc) chemistry using a peptide synthesizer SyroWave (Biotage, Uppsala, Sweden). Fmoc amino acids were purchased from Watanabe Chemical Industries and contained the following side chain protecting groups ...
-
No products found
because this supplier's products are not listed.
José Gustavo Ramírez-Paredez, et al.,
bioRxiv - Microbiology 2020
Quote:
Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Magen E. Francis, et al.,
bioRxiv - Microbiology 2021
Quote:
... to confirm stability of the SARS-CoV-2 virus after culture in vDMEM (DMEM (Dulbecco’s Modified Eagle Medium) (Wisent Bioproducts (Cat # 319-005-CL)) ...
-
No products found
because this supplier's products are not listed.
Mohan Kumar Muthu Karuppan, et al.,
bioRxiv - Immunology 2019
Quote:
... Viral proteins were purchased from ImmunoDx, Woburn ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Arthur Forer, Shotaro Otsuka,
bioRxiv - Cell Biology 2023
Quote:
Gold beads (15 nm) conjugated with Protein A (Cytodiagnostics, Burlington, Ontario, Canada) were absorbed on both sides of the sections as fiducial markers for tomography reconstruction ...
-
No products found
because this supplier's products are not listed.
Marco Losa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were dispensed at various volumes into human ASC-coated 1,536-well plates using contactless dispensing with an ECHO 555 Acoustic Dispenser (Labcyte). Thereby ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Sara B. York, et al.,
bioRxiv - Microbiology 2021
Quote:
... Zika Envelope (EastCoast Bio; HM325), Zika capsid (GeneTex ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ryouhei Tsutsumi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... EGFP-conjugated GLUT1 ligand (receptor binding domain of the human T cell leukemiavirus (HTLV) envelope glycoprotein) was purchased from Metafora Biosystems.
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti ZIKV Envelope (#BF-1176-56, BioFront Technologies) and chicken antibody to SENV (#ab33988 ...
-
No products found
because this supplier's products are not listed.
Joydeb Sinha, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Harvested virus was 0.4μM filtered (Celltreat 229749) and concentrated by centrifugation using a 100kdA cut-off PES protein concentrator (Pierce 88533 ...
-
No products found
because this supplier's products are not listed.
Chuan Xu, et al.,
bioRxiv - Immunology 2023
Quote:
Rabbit polyclonal antibodies against human or murine IFNε proteins were generated by using peptides derived from IFNε protein sequences (Lampire Biological Laboratories (Pipersville, PA). The specificity of antibodies was determined by western blot analysis ...
-
No products found
because this supplier's products are not listed.
Jonathan Burnie, et al.,
bioRxiv - Microbiology 2021
Quote:
... Viruses were produced in HEK293 using Polyjet In Vitro Transfection Reagent (FroggaBio, Cat#SL100688). HEK293 cells were seeded at a density of 106 cells/mL in 6-well plates in complete media and were transfected with 3 µg of pDNA after cells had reached 70% confluence ...
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Gabrielle Brandt, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... recombinant human transferrin (InVitria), 80 μg/mL ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Lijun Cong, et al.,
bioRxiv - Microbiology 2021
Quote:
... prior to cell supernatants being collected for quantification of virus production by HIV-1 p24 ELISA (XpressBio).
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... a pooled digest (3 µg of protein from the fifteen 15 µg samples) was applied to an SCX MicroSpin column (The Nest Group, Inc.) according to manufacturer’s instructions and fractionated using 50 mM ...
-
No products found
because this supplier's products are not listed.
Tracy J. Berg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary human astrocytes (3H Biomedical) were cultured in Astrocyte Medium (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Cameron O. Zadeh, et al.,
bioRxiv - Biochemistry 2021
Quote:
Horizontal electrophoresis was carried out using the Flatbed Professional (Gel Company Store, FC-EDCProf-2836). The apparatus was maintained at 10°C during electrophoresis ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
... by incubating the yeast with a 1:1000 dilution of Chicken anti C-MYC Epitope Tag Primary Antibody from Exalpha Biologicals Inc ...
-
No products found
because this supplier's products are not listed.
M Azharuddin, et al.,
bioRxiv - Immunology 2021
Quote:
... or anti-human IgA-HRP (Nordic BioSite, Täby, Sweden) was added to separate wells with diluted serum samples and incubated 90 min ...
-
No products found
because this supplier's products are not listed.
Astrid Hendriks, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human neutrophils were freshly isolated using Polymorphprep (Alere technologies) per manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Helene Jahn, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Protein concentration was determined by SDS-PAGE (Coomassie or Fluorescence Protein gel stain (Lamda Biotech)) in comparison with standards ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Haiyan Jia, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Small RNA-seq library construction was performed using the Perkin Elmer’s Bio Scientific NEXTflex Small RNA-Seq Kit v3 and bar-coded with individual tags following the manufacturer’s instructions (Bioo Scientific Corp, Austin, TX). Libraries were prepared on a Perkin Elmer’s Sciclone G3 NGS Workstation Liquid Handling System ...
-
No products found
because this supplier's products are not listed.
Noriki Fujimoto, et al.,
bioRxiv - Immunology 2020
Quote:
10 µg of Dil-labeled human acetylated LDL (Kalen Biomedical, Germantown, MD) or 10 µg of Dil-labeled human oxidized LDL (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Paresh P Kulkarni, et al.,
bioRxiv - Cell Biology 2023
Quote:
Protein C activity in WT and Apoh-/- plasma was performed using the Chromogenix Coamatic Protein C activity kit (Diapharma). Briefly ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Qiyue Ding, et al.,
bioRxiv - Biochemistry 2020
Quote:
Protein thiol redox states were monitored using the -SulfoBiotics- Protein Redox State Monitoring Kit Plus (Catalog # SB12; Dojindo Molecular Technologies). Samples were labeled with the Protein-SHifter Plus in accordance with the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Justin Judd, Jonathan Lovas, Guo N. Huang,
bioRxiv - Developmental Biology 2019
Quote:
... Proteins were then transferred to PVDF-Plus membranes (Spectrum Chemical) and blocked in 5% milk in TBST (0.1% Tween 20) ...