-
No products found
because this supplier's products are not listed.
Valerie Siahaan, et al.,
bioRxiv - Cell Biology 2024
Quote:
... were polymerized from 4 mg/ml tubulin for 2 h at 37°C in BRB80 supplemented with 1mM MgCl2 and 1mM GMPCPP (#NU-405, Jena Bioscience). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
No products found
because this supplier's products are not listed.
Thomas W. Rosahl, et al.,
bioRxiv - Physiology 2021
Quote:
... blots were probed with antibodies against the extracellular domain of TMEM27 (LS-C125384, LifeSpan BioSciences, Inc., Seattle, WA, USA) or anti-M2 (FLAG ...
-
No products found
because this supplier's products are not listed.
Andrew LaPoint, et al.,
bioRxiv - Physiology 2023
Quote:
... and cholesterol (2%) (HFHF-C, Research Diets, D09100310) diet or a matched sucrose ...
-
No products found
because this supplier's products are not listed.
Sarah Smith, Jessica Larsen,
bioRxiv - Pathology 2020
Quote:
... 4-methylumbelliferyl 6-sulfa-2-acetoamido-2-deoxy-b-D-glucopyranosidase (Toronto Research Chemicals, Cat. No. M335000, Ontario Canada), and 4-methylumbelliferyl N-acetyl b-D-glucosaminide (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
HEp-2 slides (Antibodies Incorporated) were used according to manufacturer’s protocol with serum diluted 1:50 in 2% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Lin, et al.,
bioRxiv - Biophysics 2023
Quote:
... and hand-packing into a column (2 mm ID × 2 cm, IDEX C-130B). After digestion ...
-
No products found
because this supplier's products are not listed.
Joaquín Miguel Pellegrini, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were then incubated with mouse anti-human LC3A/B antibody (MBL International, M152-3) for 20 min ...
-
No products found
because this supplier's products are not listed.
Mark A. Rishavy, et al.,
bioRxiv - Biochemistry 2019
Quote:
... fIX -18/+41 (the propeptide and Gla domain of factor IX, Anaspec), 1 uM ...
-
No products found
because this supplier's products are not listed.
Li Ma, et al.,
bioRxiv - Cell Biology 2023
Quote:
... HA tagged hNHE6.2-FL and Cytoplasmic domain (CD) were cloned by GeneCopoeia. hNHE1-HA (3X on c-terminal ...
-
No products found
because this supplier's products are not listed.
Erich D. Jarvis, et al.,
bioRxiv - Genomics 2022
Quote:
... All data types (Pacbio CLR ...
-
No products found
because this supplier's products are not listed.
Dan Kozome, Adnan Sljoka, Paola Laurino,
bioRxiv - Biochemistry 2024
Quote:
... Well-formed crystals of Anc4 + Loop II + A and Anc4 + Loop II + A+B+C were obtained using Eco-screen (Molecular Dimensions) at the condition (25% (w/v ...
-
No products found
because this supplier's products are not listed.
Yunliang Zang, Eve Marder,
bioRxiv - Neuroscience 2021
Quote:
... A-type K current (IKA) and leak current (Ileak) ...
-
No products found
because this supplier's products are not listed.
Weikang Chen, et al.,
bioRxiv - Microbiology 2021
Quote:
... were purchased from the China Center for Type Culture Collection (CCTCC, China) and cultured in endothelial cell growth medium 2 BulletKit (ScienCell). Human embryonic kidney (HEK ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Sonam Gurung, et al.,
bioRxiv - Genetics 2023
Quote:
... respectively (BioSpec B-GA 12S2), 86 mm volume coil ...
-
No products found
because this supplier's products are not listed.
Joel Lang Yi Ang, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and Rhodamine B (A5102, TCI) fluorescence stains were prepared at various concentrations for optimal staining of different tissue types ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
... (2) incubated with rabbit anti-N.g antibody (Fitzgerald Ind.) in the presence (ΔdotA infections ...
-
No products found
because this supplier's products are not listed.
Linshan Sun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Primary antibodies: c-Fos (CST, #2250) and tyrosine hydroxylase (TH) (ImmunoStar, #22941). The numbers of c-Fos ...
-
No products found
because this supplier's products are not listed.
Sharon R. Stevens, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Wisteria Floribunda lectins used were: Fluorescein labeled (Vector Laboratories Cat# FL-1351, RRID:AB_2336875 and Bioworld Cat# 21761065-1, RRID:AB_2833087), and Texas-Red (EY Laboratories Cat# F-3101-1 ...
-
No products found
because this supplier's products are not listed.
Sebastian Dieckmann, et al.,
bioRxiv - Physiology 2021
Quote:
... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Julie G Burel, et al.,
bioRxiv - Immunology 2020
Quote:
... 2 μl of anti-human CD19-PECy7 antibody (clone HIB19, TONBO biosciences), and 3 μl of anti-human TCRab-AF488 antibody (clone IP26 ...
-
No products found
because this supplier's products are not listed.
Florian A. Lempp, et al.,
bioRxiv - Microbiology 2021
Quote:
... cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP_009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Peter Kirchweger, et al.,
bioRxiv - Microbiology 2019
Quote:
... we incubated a purified ppr-SiiA sample over a period of 2 days at 20°C with limited amounts of thermolysin (Hampton Research, Aliso Viejo ...
-
No products found
because this supplier's products are not listed.
Yevgen Zolotarov, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 2 mM L-glutamine at 37 °C in a humidified incubator with 5% (v/v) CO2 (New Brunswick Galaxy 170s). Cells were seeded 6 hours before transient transfection with Lipofectamine 2,000 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Feng Li, et al.,
bioRxiv - Genetics 2019
Quote:
A Hi-C library was constructed with the ProxiMeta Hi-C kit from Phase Genomics v 1.0 containing the enzyme Sau3A ...
-
No products found
because this supplier's products are not listed.
Susanne N. Walker, et al.,
bioRxiv - Immunology 2020
Quote:
... Followed by capture of SARS-CoV-2 receptor binding domain which was biotinylated using the lightning-link type-A biotinylation kit(Expedeon/Abcam, 370-0005) for 180s at 10ul/min ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... vulgare β-1,3-endoglucanase (GH17 family HvBGLUII, E-LAMHV in 50% glycerol, Megazyme). TLE or H ...
-
No products found
because this supplier's products are not listed.
Lise Hunault, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-toxin B biotinylated antibody (BBI solutions, Madison, WI) followed by high sensitivity Streptavidin-HRP conjugate (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Yosif Zaki, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Layers of adhesive cement (C&B Metabond) followed by dental cement (A-M Systems) were spread over the surgical site ...
-
No products found
because this supplier's products are not listed.
Mahdi Ghorbani, et al.,
bioRxiv - Biophysics 2024
Quote:
... The mutant ΔPAS EAG1 channel in pGH19 with the deletion of the PAS domain residues 2-130 was generated by Bio Basic Inc ...
-
No products found
because this supplier's products are not listed.
Cheyenne M. Anderson, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Ultrathin sections (∼60 to 70 nm) were cut using a diamond knife (type ultra 35°C; Diatome), mounted on copper grids (FCFT300-CU-50 ...
-
No products found
because this supplier's products are not listed.
Scott E. James, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and PB-SIN-puro include the backbone and ITR and insulator domains of the piggybac transposon vector PB-EF1α-MCS-IRES-GFP (System Biosciences PB530A-2) and contain a 5’ compound SV40 enhancer with hybrid RSV-MMSV LTR (based on SERS11 design66) ...
-
No products found
because this supplier's products are not listed.
Peter Koppensteiner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in 2% BSA in TBS at 4 °C for 2 O/N and respective 1.4 nm gold-conjugated secondary antibodies (Nanoprobes Inc., USA) for silver intensification or in biotinylated anti-rabbit secondary antibody (Vector Labs ...
-
No products found
because this supplier's products are not listed.
Haoxuan Chen, Xinyue Li, Maosheng Yao,
bioRxiv - Biochemistry 2020
Quote:
... All tests were performed inside a Class 2 Type A2 Biological Safety Cabinet (NuAire, Plymouth, MN), and all exposure toxicants were ventilated out via the built-in and lab ventilation system.
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... A SARS-CoV-2 neutralization antibody (EpiGentek), which targets the spike RBD ...
-
No products found
because this supplier's products are not listed.
Hoai Thi Thu Tran, et al.,
bioRxiv - Microbiology 2022
Quote:
SARS-CoV-2 Spike B.1.1.529 (Omicron) variant pseudotyped lentivirus particles were purchased from Biomol (Hamburg, Germany). The transduction assay was performed as described previously [12] ...
-
No products found
because this supplier's products are not listed.
Joseph C. Maggiore, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Media for both dissociated cells and explants consisted of neurobasal medium + 2% B-27 + 400-500 μm L-glutamine + 1% fetal bovine serum (Atlanta Biologicals) + 2.0-2.5 mg/mL glucose + 10-20 ng/mL 2.5S nerve growth factor ...
-
No products found
because this supplier's products are not listed.
Jacqueline A. Burke, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the solution from b) and c) were collected and measured using an insulin ELISA kit (Thermo Fisher for mouse islets, and Mercodia for human islets). The stimulation index was defined as the ratio of stimulated (high glucose ...
-
No products found
because this supplier's products are not listed.
Timothy J. Aikin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Prime 95-B sCMOS camera (Photometrics) and a Multiline laser launch (Cairn Research ...
-
No products found
because this supplier's products are not listed.
Priya Crosby, et al.,
bioRxiv - Biochemistry 2023
Quote:
Mouse CRY1 PHR domain (residues 1-491) was expressed in Sf9 suspension insect cells (Expression Systems) as previously described (Parico et al. ...
-
No products found
because this supplier's products are not listed.
Matthew J. Lollar, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... 54 g agar (Genesee Drosophila type II), 20 mL propionic acid ...
-
No products found
because this supplier's products are not listed.
Jacqueline F. Rivera, et al.,
bioRxiv - Neuroscience 2023
Quote:
The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
No products found
because this supplier's products are not listed.
Michael J. Byron, et al.,
bioRxiv - Physiology 2019
Quote:
... and incubated overnight at 4°C with a primary antibody (Aviva Systems Biology ARP55440_P050) diluted 1:1000 in 1% milk ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Taru Hilander, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 1% N-Dodecyl-b-D-Maltoside (Amresco, J424,), 1% Phenylmethanesulfonyl fluoride (PMSF ...
-
No products found
because this supplier's products are not listed.
Mohamad El Shami, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... amphotericin B (250 ng/mL, Gemini Bio-Products 400104), and Plasmocin (2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Shi-Xun Ma, et al.,
bioRxiv - Neuroscience 2020
Quote:
F2 SILAM wide type female mice were purchased from Cambridge Isotope Laboratories and then crossed with regular C57BL6 wild type males by fed with stable isotope labeling using amino acids in cell culture (SILAC ...
-
No products found
because this supplier's products are not listed.
Miquel Sendra, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... embryos were washed for 2 days at 4◦C and then incubated for 5 minutes with TSA Cyanine 5 at room temperature (NEL705A001, Akoya, biosciences). All embryos were nuclei stained with DAPI 1:1000 diluted in PBS ...
-
No products found
because this supplier's products are not listed.
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1 mM 2’F-Py (2’F-2’-dCTP and 2’F-2’-dUTP, TriLink Biotechnologies), 1 mM ATP ...