Labshake search
Citations for Bioline :
1 - 50 of 64 citations for C Type Lectin Domain Family 2 Member B CLEC2B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Genetics 2021Quote: ... and then digested with proteinase K (20 μg per sample at 56°C for 2 h; Bioline, cat. # 37084), and electrophoresed on a 1.5% agarose gel to verify that the majority of fragments were 100-400 bp in size ...
-
bioRxiv - Cell Biology 2021Quote: ... The interaction between the protein products fused to the DNA binding and activation domains were analyzed by the activity of β-galactosidase by the cleavage of X-Gal (BIO-37035, Bioline, UK). For detecting the β-galactosidase activity overlaying of low melting agarose with X-Gal (over lay mix was prepared freshly) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed with 0.25-1 µg of RNA in a 20 µL total reaction volume using a random hexamer/oligo dT strand synthesis kit as per the manufacturer’s instructions (10 min at 25°C; 15 min at 42°C; 15 min at 48°C; SensiFast, Bioline). All oligonucleotide sequences are listed in Table 1.
-
bioRxiv - Microbiology 2020Quote: ... and cDNA synthesized with 0.25-1μg of RNA in a 20μL total reaction volume using a random hexamer/oligo dT strand synthesis kit in accordance with the manufacturer’s instructions (10 minutes at 25°C; 15 minutes at 42°C; 15 minutes at 48°C; SensiFast, Bioline). PCR amplification of HBV RNAs were performed using primers as previously described43 using a SYBR green real-time PCR protocol (qPCRBIO SyGreen ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from a total of 106 B cells purified from spleen or lymph nodes or 105 B cells sorted from the B:T co-cultures (72 h) using TRIsure™ (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C for 30 min and then proteinase K digestion (Bioline, cat. #37084) for 2 h at 56 °C ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at 37°C and proteinase K (40 ug, Bioline BIO-37084) for 2 hours at 55°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of MyTaq™ 5x reaction buffer (Bioline), 0.08 μL of each primers ...
-
bioRxiv - Microbiology 2021Quote: ... and 2× My Taq Red (Bioline, Taunton, MA, USA). The PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Genomics 2019Quote: ... pool C was diluted 1,000-fold and 1.5 fmol were amplified using VELOCITY DNA polymerase (Bioline) with forward primer pool-FP1 and reverse primer pool-RP2 using the following PCR conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SensiMix SYBR Low-ROX Kit (Bioline; annealing temperature – 60°C) in a Lightcycler 480 384-well plate (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cross-linking was reversed by overnight incubation at 60°C with proteinase K (Bioline, Lot # BIO-37037). Then 3C libraries were purified by phenol-chloroform followed by chloroform extraction and ethanol-precipitated at −80°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... for 14 hours at 37 °C in the presence of RiboSafe RNAse Inhibitor (Bioline, cat. number BIO-65028). Next ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 μl of digest were run on 2 % agarose gel (BIOLINE, London, UK) and imaged on a trans illuminator ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the 2× SYBR Green PCR Master Mix (Bioline) with the CFX96 detection system and analyzed with CFX Manager softward (Bio-rad) ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were run on 0.8-2% agarose gels (Bioline, Cat#: BIO-41025), depending on fragment size ...
-
bioRxiv - Plant Biology 2020Quote: ... The digested product was visualized on a 2% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 90 min and the genotype of each line at the SNP position was confirmed according to the product bands on the gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were separated by gel electrophoresis on 2% DNA grade agarose (Bioline) gels in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 μl of 1:10 diluted cDNA and BIOTAQ™ DNA polymerase (Bioline GmbH) were used in a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of diluted cDNA were combined with 5 μL SYBR Green (Bioline, Luckenwalde, Germany), 0.2 μL of each forward and reverse primer and 4.6 μL DEPC-water ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Cell Biology 2019Quote: ... The hPL-PIPC units were distributed into 45 mL aliquots and stored at −20°C in a freezer (Gram BioLine, Vojens, Denmark). In addition ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µg of total RNA was used to prepare cDNA with SensiFast cDNA synthesis kit (Bioline) according to the manufacturer’s instructions and diluted 1:6 with DNAse/RNAse-free water (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline), 0.25 μM each of RamF6 and RamR6 primers (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was converted to cDNA using the SensiFAST cDNA kit (#BIO-65053, BioLine) with 10 μL of RNA extract per reaction following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline, Australia), 0.25 μM of each forward and reverse primer (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µg RNA (fractionation) or 11µl RNA (RNA immunoprecipitation) was converted to cDNA using BioScript Reverse Transcriptase (Bioline). Primers used in this study are provided in Supplementary Table 3 ...
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were size separated by gel electrophoresis on a gel composed of 2% DNA grade agarose (Bioline) in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reactions were performed in a total volume of 25 μl containing 12.5 μl 2 x MyTaq Red (Bioline, UK), 0.5 μl of each 10 μM primer stock ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was made from 2 μg of RNA using the Tetro cDNA synthesis kit with DNase treatment according to manufacturer’s instructions (Bioline). cDNA was diluted 1 to 5 into RNAse free water to a total of 100 μl ...
-
bioRxiv - Genetics 2022Quote: ... Genotyping was performed directly from the lysates with region targeting primers (Supplementary Table 2) and MyTaq Red Mix (Bioline) followed by gel electrophoresis to reveal biallelic knockout clones ...