Labshake search
Citations for Bio Basic :
1 - 23 of 23 citations for C Type Lectin Domain Family 2 Member B CLEC2B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The mutant ΔPAS EAG1 channel in pGH19 with the deletion of the PAS domain residues 2-130 was generated by Bio Basic Inc ...
-
bioRxiv - Evolutionary Biology 2023Quote: The wild-type (wt) VIM-2 gene including its signal peptide sequence was synthesized (Bio Basic Inc.) and subcloned into a low-copy number plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Immunology 2020Quote: ... Lm-OVA stocks frozen at −80 C were grown overnight at 37°C in BHI broth supplemented with 5 ug/ml Erythromycin (Bio Basic, Amherst, New York). Then ...
-
bioRxiv - Immunology 2020Quote: ... Cytochrome C was obtained from Bio Basic (Markham, ON, Canada). Human MPO and human Lactoferrin ELISA kits were purchased from Assaypro (St ...
-
bioRxiv - Microbiology 2021Quote: ... a set of overlapping cDNA fragments representing the entire genomes of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) and the B.1.1.7 alpha variant were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc and Genewiz, respectively). The cDNA fragment representing the 5’ terminus of the viral genome contained the bacteriophage T7 RNA polymerase promoter preceded by a short sequence stretch homologous to the XhoI-cut end of the TAR in yeast vector pEB2(Gaida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... a set of overlapping cDNA fragments representing the entire genomes of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) and the B.1.1.7 alpha variant were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc and Genewiz, respectively). The cDNA fragment representing the 5’ terminus of the viral genome contained the bacteriophage T7 RNA polymerase promoter preceded by a short sequence stretch homologous to the XhoI-cut end of the TAR in yeast vector pEB2 [64] ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 2-170 NSP3 Mac1 was cloned into a pET-11a plasmid (Bio Basic) and transformed into E ...
-
bioRxiv - Immunology 2024Quote: ... 1.5 mM MgCl2 and 2 mM MgSO4 (Bio Basic) in a total volume of 20 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... selection was performed using 2 µg/ml of puromycin (Bio Basic) to collect cells expressing the desired shRNAs ...
-
bioRxiv - Genomics 2022Quote: ... and resuspended in prewarmed 30°C 50 ml YPD supplemented with 50 ug/ml Pronase and 0.2M Hydroxyurea (Bio Basic HB0528). Cells were pelleted again ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated for 60 min at 37°C with 10 pg µl-1 of RNase A (Bio Basic, Toronto, Canada). RNase activity was inactivated by adding 100 unites of Protector RNase Inhibitor (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... To quench the reaction 1.5 μL of 0.5 M EDTA pH 8.0 was added and the reaction subsequently heated to 75°C for 10 min before the RNA was purified via EZ-10 Spin Column RNA Cleanup and Concentration Kit (Bio Basic).
-
bioRxiv - Biochemistry 2019Quote: ... was synthesized and cloned into a modified pEG BacMam vector 32 in frame with a C-terminal FLAG affinity tag (Bio Basic Inc.). The full length wild-type protein was expressed by baculovirus-mediated transduction of HEK293S GnTI− (N-acetylglucosaminyltransferase I-negative ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S) with 25 ng cDNA per reaction and primers targeting mouse Sumo1 (NM_009460.2 ...
-
bioRxiv - Microbiology 2020Quote: GM (2 mg/mL) solution was prepared using gentamicin sulfate of USP grade produced by BIO BASIC INC (Toronto ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S) with 25 ng cDNA per reaction and primers targeting mouse Gapdh (Forward ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 S-expressing plasmids were codon-optimized and generated by gene synthesis (Bio Basic Asia Pacific) according to GenBank accession QHD43416.1 ...
-
bioRxiv - Microbiology 2020Quote: ... the entire genome sequence of SARS-CoV-2 USA/WA1/2020 (GenBank accession no. MN985325) was chemically synthesized (Bio Basic) in five fragments and cloned into pUC57 plasmids containing unique restriction sites ...
-
bioRxiv - Microbiology 2021Quote: ... a set of overlapping cDNA fragments representing the entire genome of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc). Where appropriate the relevant synthetic cDNA fragment carried the mutation D614G or Y453F + D614G in the viral S gene ...
-
bioRxiv - Biophysics 2021Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility ...
-
bioRxiv - Biophysics 2022Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility (10) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated with antibodies in a solution of Tris-buffered saline (cat. no. A0027, BIO BASIC, Markham ON, Canada) at 4°C for overnight ...