Labshake search
Citations for GeneCopoeia :
1 - 35 of 35 citations for C Type Lectin Domain Family 2 Member B CLEC2B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... HA tagged hNHE6.2-FL and Cytoplasmic domain (CD) were cloned by GeneCopoeia. hNHE1-HA (3X on c-terminal ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... and Grp94 (MCP230394-CG12-3-B) were obtained from Genecopoeia (Rockville, MD). The DNA was amplified using standard molecular biology approaches ...
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Biochemistry 2020Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia). In the case of PPC variants ...
-
bioRxiv - Neuroscience 2022Quote: ... The mutant sequence or wild-type sequence of HDAC6 were respectively cloned on the overexpression plasmid vector Lv206 (GeneCopoeia) (Fig EV5B) ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia, Rockville, MD, USA). The obtained fragment was cloned into pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...
-
bioRxiv - Microbiology 2021Quote: ... McLellan) with a removable C-terminal twin-strep tag was transfected into cells with EndoFectin Max (GeneCopoeia) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... MT-5 cell line were also transduced to stably express luciferase using LentifectTM (GeneCopoeia #LPP-HLUC-Lv105-025-C) lentiviral vectors of firefly luciferase ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: cDNAs cloned and inserted into pReceiver-M03 vector driven by CMV promoter with c-terminal GFP were purchased from Genecopoeia (Alox12 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...