-
No products found
because this supplier's products are not listed.
El Batoul Djouani-Tahri, et al.,
bioRxiv - Plant Biology 2023
Quote:
... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
No products found
because this supplier's products are not listed.
Eugenie Dubnau, Micaela DeSantis, David Dubnau,
bioRxiv - Microbiology 2023
Quote:
... and the bands were developed using disodium 3-[4-methoxyspiro [1,2-dioxetane-3,2’-(5’-chloro)tricyclo (3.3.1.13,7) decan]-4-yl]phenyl phosphate (CSPD; Sigma-Aldrich} ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... methyl]-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine 4-amino-1-tert-butyl-3-(3-bromobenzyl)pyrazolo[3,4-d]pyrimidine (3BrB-PP1) (Abcam; ab143756) for 30 min ...
-
No products found
because this supplier's products are not listed.
Erin Moran, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The ATP analogue 1-naphthyl-pyrazolo[3,4-d]pyrimidine (NAPP, Cayman Chemicals) was added to YPD at 75 μM ...
-
No products found
because this supplier's products are not listed.
Naveen Thakur, et al.,
bioRxiv - Biophysics 2023
Quote:
... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Amoldeep S. Kainth, Hesheng Zhang, David S. Gross,
bioRxiv - Genetics 2024
Quote:
... then 1-NM-PP1 (4-amino-1-tert-butyl-3-(1’-naphthylmethyl)pyrazolo[3-4-d]pyrimidine) (Toronto Research Chemicals, Inc.; no. A603003) was added to a final concentration of 15 μM ...
-
No products found
because this supplier's products are not listed.
Niclas Nordholt, et al.,
bioRxiv - Microbiology 2022
Quote:
... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Alison Dumont, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3/7 dye (4440, Sartorius, 1/1000) and/or propidium Iodide (PI ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng ml−1 recombinant human IL-7 (Peprotech) and 5 ng ml−1 IL-15 ...
-
No products found
because this supplier's products are not listed.
Tom Lemonnier, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Phenyl-Superose HR5/5 and Superose 12 HR10/30 were from GE Healthcare.
-
No products found
because this supplier's products are not listed.
Reeku Chaudhary, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Maria João Ferreira, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 1 mg/mL X-Gluc (5-bromo-4-chloro-3-indolyl β-D-glucuronic cyclohexylammonium salt; Biosynth)] ON at 37°C ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Yi-Wei Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
COS-7 cells (∼ 3-5 x 104) were grown on 8-well chamber glass slides (BD Falcon 8 chamber tissue culture-treated glass slides ...
-
No products found
because this supplier's products are not listed.
Florian U Moeller, et al.,
bioRxiv - Microbiology 2019
Quote:
... we used the AOA-specific inhibitor PTIO (2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl 3-oxide; Tokyo Chemical Industry) (Martens-Habbena et al. ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Ryley Collard, et al.,
bioRxiv - Neuroscience 2022
Quote:
... CD-1 (5-7 weeks old, Charles River Laboratories, Kingston, NY, USA), and CF-1 (5-7 weeks old ...
-
No products found
because this supplier's products are not listed.
Ole A.W. Haabeth, et al.,
bioRxiv - Immunology 2021
Quote:
... After washing wells were incubated with a 5-bromo-4-chloro-3⍰-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (R&D systems, mouse IFNγ Kit Cat # EL485). Plates were scanned and analyzed using ImmunoSpot Microanalyzer.
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Alan Hicks, et al.,
bioRxiv - Biophysics 2020
Quote:
... or (iv) POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) at 7:3 ratio (all lipids from Avanti Polar Lipids). The protein-liposome mixtures ...
-
No products found
because this supplier's products are not listed.
Annette Brandel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were cultivated four days in the presence of 2.5 μM D-threo-l-phenyl-2-palmitoylarmino-3-morpholino-l-propanol (PPMP; Santa Cruz) to inhibit synthesis of glucosylceramide-based GSLs [41].
-
3-chloro-5-hydroxybenzoic Acid is a selective agonist of the lactate receptor GPR81.
Cat# S5400, SKU# S5400-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Tomasz H. Benedyk, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 1 μL of 3-azido-7-hydroxycoumarin solution (1 mM in EtOH; Jena Bioscience) was added ...
-
No products found
because this supplier's products are not listed.
Matthew T. Blahna, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Supernatant medium from treated PASM cells was mixed 1:1 with 25 µL Caspase-Glo 3/7 substrate in a solid white polystyrene 96-well Assay Plate (Corning) and set at room temperature for 30 min prior to reading with a GloMax luminometer (Promega) ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Alissandra L. Hillis, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and 1:1000 NucView 488 Caspase-3/7 substrate (Biotium, 30029). Cells were treated with 10 µL of drug-containing media ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... IL-7 (5 ng/mL) (Stemcell Technologies, Cat.#78053), IL-15 (5 ng/mL ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
Cat# HY-136658,
inquire
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652; MedChemExpress, Sollentuna, Sweden). DMSO served as a solvent control (0.1% in cell culture medium).
-
No products found
because this supplier's products are not listed.
Sangin Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-chloro-2ʹ-deoxyuridine (CldU) (#105478) (MP Biomedicals); Shield1 (632189 ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Alexandra A. Vetrova, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Sections (5-7 μm thick) were cut using Reichert-Jung (Leica) Ultra-cut 701701 ultramicrotome (Reichert-Jung ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-Siglec-7 (Proteintech, 13939-1-AP, 1:200), anti-CD14 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... Doxycycline and 5-Phenyl-1-pentanol were obtained from Alfa Aesar (Tewksbury, MA). Nile red ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).