-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Christopher E McMurran, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 2µl was injected onto a 50m x 0.25mm (5% phenyl-arylene, 95% dimethylsiloxane) column with a 0.25µm ZB-5MS stationary phase (Phenomenex, Macclesfield, UK). Full-scan spectra were collected at three scans per second over a range of 50 to 650 m/z ...
-
No products found
because this supplier's products are not listed.
Julia Fadjukov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Patch pipettes (5–7 MΩ, BF120-69-10, Sutter Instruments) were filled with an intracellular solution composed of (in mM) ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
Two times crystallized from dilute alcohol. A lyophilized powder.
Cat# LS003317,
10 gm, $700.00
Ask
Kai Guo, et al.,
bioRxiv - Immunology 2022
Quote:
... in DMEM containing 0.0002% L-1-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical) with antibiotics ...
-
No products found
because this supplier's products are not listed.
Neil Fleck, Christoph Grundner,
bioRxiv - Genetics 2021
Quote:
... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
No products found
because this supplier's products are not listed.
Kemin Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... Co- transfection of those plasmids were performed at a density of 4-5 million cells/mL in a 1:3 ratio (weight: weight) of plasmids to PEImax at 1 mg/ml (Polysciences). Following a 4-day incubation ...
-
No products found
because this supplier's products are not listed.
Valencia L. Potter, et al.,
bioRxiv - Cell Biology 2020
Quote:
Eye cups from mice aged 4-8 months (Figures 2–5) or 10 days postnatal (Figures 6, 7, 9) were fixed for five minutes in 1% PFA (Electron Microscopy Science) diluted in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Rukesh Chinthapatla, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cytidine 5’-O-(1-thiotriphosphate) and 3’-deoxycytidine 5’-triphosphate were from TriLink. Adenosine 5’-O-(1-thiotriphosphate ...
-
No products found
because this supplier's products are not listed.
Martijn Cordes, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng/ml human IL-7 (Miltenyi Biotec), and 5 ng/ml human FLT3L (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Ichia Chen, et al.,
bioRxiv - Biophysics 2020
Quote:
... 5 mM Na-Asp and 7 mM n-decyl-β-D-maltopyranoside (C10M; Anatrace). For GltPh-XL2 and GltPh-XL3 ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Pazhanichamy Kalailingam, et al.,
bioRxiv - Pathology 2024
Quote:
... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Vipin Rawat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... After 5-7 days cells were counted using a Z1 Coulter Particle Counter (Beckman Coulter).
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Chikako Okubo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse monoclonal anti-p53 (DO-7) (1:200, Novus Biologicals), goat polyclonal anti-p53 (1:100 ...
-
No products found
because this supplier's products are not listed.
Katrina M. MacLeod, Sangeeta Pandya,
bioRxiv - Neuroscience 2021
Quote:
... rabbit anti-synaptotagmin 7 (Syt7) (Synaptic Systems cat#105173, 1:3k), rabbit anti-VGluT2 (Synaptic Systems ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Emmanuelle Grall, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Signal amplification was done with 1:50 TSA Plus Cyanine-3 or -5 (Akoya Biosciences) for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Jessica M Snyder, et al.,
bioRxiv - Pathology 2020
Quote:
... 7 Cyp26b1−/− (3M, 4F), and 6 Cyp26b1+/− (3M ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
Building Block
Sold for research purposes only.
Cat# 1117.0, SKU# 1117-1000 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Walid Sadok, Remy Schoppach,
bioRxiv - Plant Biology 2019
Quote:
... C613-phenyl-IAA (50 pmol, Cambridge Isotope Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Bianca Dietrich, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... inhibition of NOTCH signalling in P1 organoids was achieved by adding either 50 µM [(2R,4R,5S)-2-benzyl-5-(Boc-amino)-4-hydroxy-6-phenyl-hexanoyl]-Leu-Phe-NH2 trifluoroacetate salt (L-685,458; Bachem) or 10 µM Deshydroxy LY-411575 (DBZ ...
-
No products found
because this supplier's products are not listed.
V. E. Dunlock, et al.,
bioRxiv - Immunology 2019
Quote:
... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Ryan A.V. Bell, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and recombinant active caspase 3 (0.5 μg; Chemicon) or recombinant active caspase 7 (0.5 μg; Biovision) were incubated for 3 h in cleavage assay buffer (50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Marcin Poreba, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Fluorescent tags (Cyanine-5 NHS and Cyanine-7 NHS) were purchased from Lumiprobe (Hannover, Germany). Diazomethane was generated according to the Aldrich Technical Bulletin (AL-180 ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Y. Shi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 0.5mM adenosine 3’,5’-cyclic monophosphate (cAMP, Enzo Life Science), 2ng/ml transforming growth factor beta 3 (TGFβ3 ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories). RBD antigen binding during selection Round 4 was evaluated using a 1:1000 dilution of Streptavidin-Alexa Fluor 647 secondary (Jackson ImmunoResearch) ...
-
No products found
because this supplier's products are not listed.
Lihong Wang-Bishop, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Mice in groups receiving αPD-1 and αCTLA-4 (100 µg, every 3 days for 5 injections, BioXcell, West Lebanon NH) were treated intraperitoneally ...
-
No products found
because this supplier's products are not listed.
Erica A. Birkholz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-7 µl of cells were deposited on R2/1 Cu 200 grids (Quantifoil) that had been glow-discharged for 1 min at 0.19 mbar and 20 mA in a PELCO easiGlow device shortly before use ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We detected the bound alkaline phosphatase labeled antibodies by incubating the membrane in BCIP/NBT (5-bromo, 4-chloro, 3- indolylphosphate/nitro-blue tetrazolium, AMRESCO, LLC.) substrate for 30–45 minutes ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Hailing Zong, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 70 µl of cells at 5-7×105 cells/ml were seeded into a Culture-Insert 2 Well (ibidi) and grown to confluency ...