-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Jiali Yu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 500 μM indole-3-acetic acid (IAA, chemical analog of auxin, C3290, APExBIO) was used to induce CTCF degradation.
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... 1h DMEM w/o amino acids (Biomol GmbH) + 10% dialyzed FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Ziad Jowhar, et al.,
bioRxiv - Genomics 2023
Quote:
... the media was changed and fresh media with 500 μM IAA (Indole- 3-acetic acid, the most common naturally occurring Auxin hormone) (Research Products International, cat: I54000-5.0) or DMSO was added to cells ...
-
No products found
because this supplier's products are not listed.
Georgia Charkoftaki, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 7-ketodeoxycholate and 7-ketolithocholic acid were purchased from Toronto Research Chemicals (North York, ON, Canada). Formic acid (99+% ...
-
No products found
because this supplier's products are not listed.
Ruchira Mukherji, et al.,
bioRxiv - Microbiology 2019
Quote:
... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ...
-
No products found
because this supplier's products are not listed.
Changliang Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
François Halloy, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 5-(Benzylthio)-1H-tetrazole (Carbosynth) was used at 0.24 M concentration in dry acetonitrile to activate the phosphoramidites for coupling ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1H NMR (JEOL, Tokyo, Japan) (400 MHz ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Haribaskar Ramachandran, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were blocked with 3%BSA diluted in PBS for 1h at RT and then incubated with anti-CD-19-PE antibody (1:50) in 3% BSA-PBS (Miltenyi Biotec) for 1h at RT ...
-
No products found
because this supplier's products are not listed.
Bibek Aryal, et al.,
bioRxiv - Plant Biology 2022
Quote:
... CLX or indole (50 μM) was quantified using a Cytation 5 reader (BioTek Instruments).
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Abdelrahim Zoued, et al.,
bioRxiv - Microbiology 2021
Quote:
... for 1h at RT without agitation and observed by light microscopy (Nikon Ti Eclipse equipped with a metal-oxide-semiconductor (sCMOS ...
-
No products found
because this supplier's products are not listed.
Pawel Leznicki, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Reactions were incubated for 1h at 22°C in a thermomixer (Eppendorf) with mixing set to 1000 rpm ...
-
No products found
because this supplier's products are not listed.
Valentina Peona, et al.,
bioRxiv - Genomics 2019
Quote:
... and with short reads using Pilon (two runs; Illumina library; Figure 1h).
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Jakub Gemperle, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Indole-3-acetic acid sodium salt (source of Auxin; Cambridge Bioscience Limited, #16954-1g-CAY) aliquiots (10 mg/ml in water ...
-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Sabrina Vullo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Oocytes used for VCF experiments were incubated after cRNA injection for 1h in Modified Barth’s Solution (MBS) containing 10 mM 3-maleimidopropionic acid (Bachem) to modify free cysteine residues of proteins natively expressed on the cell membrane ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Nicholas Dillon, et al.,
bioRxiv - Microbiology 2020
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)-phosphazene (SynQuest Labs, Inc.) was used as a “lock mass” internal calibrant (m/z 622.028960 ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
Indole-3-carboxylic acid (3-Indoleformic acid, 3-Carboxyindole, β-Indolylcarboxylic acid,...
Cat# S4860, SKU# S4860-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
Hua Lu, Mark A. Lehrman, Julie K. Pfeiffer,
bioRxiv - Microbiology 2019
Quote:
... and oligosaccharides were labeled with 7-amino-1,3-naphthalenedisulfonic acid (81529, AnaSpec) prior to electrophoresis on 20% acrylamide gels ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Lin Di, et al.,
bioRxiv - Genomics 2022
Quote:
... at 37°C for 1h and purified by Zymo columns ...
-
No products found
because this supplier's products are not listed.
Min Yao, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and human IgG ELISA kit (Mabtech, #3850-1H-6).
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... and for 1h at RT goat anti-mouse IRDye 680LT (LI-COR) which served as a loading control ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Alexis S. Bailey, Margaret T. Fuller,
bioRxiv - Developmental Biology 2023
Quote:
... TSA plus cyanine 3 solution (dilute TSA-Cy3 1:250 in 100mM Boric Acid, pH8.5 containing 0.003% H2O2) (Akoya Biosciences) was added to the tissue sections and incubated for 10 min at RT ...
-
No products found
because this supplier's products are not listed.
Adrien Birot, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
No products found
because this supplier's products are not listed.
Anne Charlotte le Floch, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were cultured O/N or 1h for SUP-T1 on dishes (Ibidi, Cat.No: 80136) precoated with poly-L-lysine ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Michael D. Roberts, et al.,
bioRxiv - Physiology 2023
Quote:
Peptides obtained from each of the five NP mixtures were separately reconstituted according in a solution of 0.1% formic acid and 3% acetonitrile (34) spiked with 5 fmol μL PepCalMix from SCIEX (Framingham, MA, USA). Reconstitution volumes varied by NP types to allow for constant peptide quantity for MS injection between samples regardless of starting volume (240 ng ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Daniel A Chaves, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...