Labshake search
Citations for Lucigen :
1 - 50 of 64 citations for 7 Benzyloxy 1H indole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco acid pyrophosphatase (TAP, Epicentre) was added to convert 5′ PPP or capped RNAs to 5′ P RNAs ...
-
bioRxiv - Genomics 2020Quote: ... both transcripts were biotin-labeled after in vitro transcription from 1µg linearized pcDNA3.1-LETR1-1 and pcDNA3.1-LETR1-1-antisense plasmids for 1h at 37°C using Ampliscribe T7-flash biotin-RNA kit (Lucigen). Biotinylated LETR1 sense and antisense RNA were then treated with RNase-free DNase I for additional 15min at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... In vitro transcribed RNA were incubated for 1h at 37°C after addition of 10units DNase I and 10units DNase Zero (Epicentre). The RNAs were then ethanol precipitated and resuspended in water ...
-
bioRxiv - Molecular Biology 2020Quote: ... In vitro transcribed RNA were incubated for 1h at 37°C after addition of 10units DNase I and 10units DNase Zero (Epicentre). The RNA were then ethanol precipitated and resuspended in water and dephosphorylated using 2units Alkaline Phosphatase (FastAP ...
-
bioRxiv - Genetics 2019Quote: ... or 2µg (25th and 100th generation samples) of RNA were incubated for 1h at 37°C with 5’ RNA polyphosphatase (Epicentre) at a final concentration of 1U/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µg of total RNA was mixed with 3 µl of diluted ERCC RNA spike-in mix and then digested for 1h at 30°C with 1 unit of Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in 1X Reaction Buffer A containing 10 units of SUPERase-In RNase inhibitor (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Free nucleic acids were digested using OmniCleave Endonuclease (Lucigen, USA) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Purified RNAs were then treated with TAP (Tobacco Acid Pyrophosphatase, Epicentre) to convert 5′ ends of RNA to monophosphate ...
-
bioRxiv - Microbiology 2019Quote: ... DNase-treated RNA was treated with Tobacco Acid Pyrophosphate (TAP) (Epicentre) at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Nucleic acids were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200) according the manufacturer’ instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Epicentre MasterPure nucleic acid extraction kit (Epicentre, Madison, WI) per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was removed and cells were resuspended in 7 mL PBS-RI (1x PBS supplemented with 0.1 U/µL NxGen RNase inhibitor (Lucigen, CN 30281)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used to in vitro transcribe a 309-nt actin RNA transcript that was subsequently cap-labeled using recombinant VACV guanylyltransferase/guanine-7-methyltransferase (Epicentre Biotechnologies) in conjunction with capping buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from the Sterivex filters using the Masterpure™ Nucleic Acid Extraction Kit (Epicentre). Six-hundred microliters of Masterpure™ Tissue and Cell Lysis Solution containing recommended quantities of proteinase K were added to each Sterivex filter ...
-
bioRxiv - Molecular Biology 2019Quote: ... and decapped using Tobacco Acid Pyrophosphatase (TAP) enzyme (Epicentre, can be replaced by RppH from NEB) and purified by phenol/chloroform extraction ...
-
bioRxiv - Cell Biology 2021Quote: ... Fungal genomic acid DNA was isolated with the MasterPureTM Yeast DNA Purification Kit (Lucigen, Wisconsin, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...