-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Rosine Manishimwe, et al.,
bioRxiv - Microbiology 2020
Quote:
... coli were tested for indole production using an indole spot test (Hardy Diagnostics, California, United States) and were confirmed as E ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5-Ethylthio-1H-tetrazole (ETT, Honeywell Research Chemicals, 0.25 M solution in acetonitrile) was used as an activator ...
-
No products found
because this supplier's products are not listed.
Anna Dopler, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-7 (ImmunoTools, 5ng/ml), IL-15 (ImmunoTools ...
-
Indole Assay Kit
Cat# DIND-100,
1.0 kit, 100 tests, USD $156.0
Ask
Kaori Kobayashi, et al.,
bioRxiv - Immunology 2021
Quote:
The concentrations of total sialic acid (TSA) and free sialic acid (FSA) in saliva were measured using a sialic acid assay kit (Bioassay Systems). The concentration of protein-bound sialic acid (BSA ...
-
No products found
because this supplier's products are not listed.
Benjamin S. O’Brien, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 7% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Zezhong Zheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
Gene editing of COS-7 cells were performed by electroporation of COS-7 cells with Super PiggyBac plasmid (PB210PA-1, System Biosciences) and one of the 5 plasmids of pBv1-EF-6X ...
-
No products found
because this supplier's products are not listed.
Stephanie Bruggink, et al.,
bioRxiv - Physiology 2021
Quote:
... A female luer (Figure 1H thread style to 500 series barb 1/16 inch ID tubing Cole-Parmer Instrument #SK-45508-01 connected to tubing Picture 1B Silastic Laboratory Tubing #508-005 ...
-
No products found
because this supplier's products are not listed.
Aldo S. Bader, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The agarose plugs were allowed to solidify at 4°C for 1h before being immersed in lysis buffer (Trevigen) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Bo Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... KCl (CAS 7447-40-7) (Spectrum Chemicals, New Brunswick, NJ) and water ...
-
No products found
because this supplier's products are not listed.
Jichuan Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
An Annexin V-APC/7-AAD Apoptosis Kit (Abnova, #KA3808) was used for the apoptosis analysis as described previously [18] ...
-
No products found
because this supplier's products are not listed.
Tingyu Han, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... (7) added BCP (Molecular Research Center, BP 151, Cincinnati, OH, USA) to the above centrifuge tubes ...
-
No products found
because this supplier's products are not listed.
Mason A. McCool, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Swollen cells were dounced using a 7 mL dounce (Wheaton, 3575420) for 20 strokes ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... and incubated for at least 1h prior to microinjection on a hot plate (38°C) under mineral oil (FUJIFILM Irvine Scientific; 9305). Oocytes were then microinjected with ~5 pl of mRNAs in M2 medium with 2.5 mM milrinone and 3mg/mL BSA at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Slawomir Kubik, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and treated with Cap-Clip Acid Pyrophosphatase (Tebu-bio). RNA was then ligated to the biotinylated 5’ adaptor and fragmented for 5 min at 70°C in fragmentation buffer (10mM ZnCl2 ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... DMA (Dimethylarsinic Acid Standard Solution, LGC Standards; NIST-3031) and MMA (Monomethylarsonic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Ludovico Cantuti-Castelvetri, et al.,
bioRxiv - Microbiology 2020
Quote:
... Then lipoic acid-PEG(1k)-NH2 (#PG2-AMLA-1k, Nanocs) was added to a final concentration of 5 µM ...
-
No products found
because this supplier's products are not listed.
Anna-Lena Steckelberg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the Nucleic Acid Mini Screen (all from Hampton Research) were used to perform initial screens at 20°C with sitting-drop vapor diffusion crystallization ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 3 µM GSK3βi/CHIR99021 (Reprocell) (‘AGi’ media ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Leandre M. Glendenning, et al.,
bioRxiv - Immunology 2023
Quote:
Sialic acids were removed from human polyclonal IgG (Innovative Research IHIUGGAP) via recombinant neuraminidase (NEB P0720L ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
K. M. Pruss, et al.,
bioRxiv - Microbiology 2020
Quote:
... Supernatant was filtered and dialyzed against dH2O with 1kD MWCO membranes (Spectra/Por 7, Spectrum Labs)) and subsequently lyophilized ...
-
No products found
because this supplier's products are not listed.
Gernot Neumayer, et al.,
bioRxiv - Bioengineering 2023
Quote:
Differentiated day 7 or enriched and expanded D50 iSCs were dissociated with Accutase (Innovative Cell Technologies) up to 30 minutes ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... followed by fixation with a 10% trichloroacetic acid (TCA; Bioshop Canada Inc) at 4°C for one hour ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Kevin S. Cannon, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lipidated YxxΦ-cargo peptide (Oleic acid-S{Lys(FITC))}KVTRRPKASDYQRL) was synthesized by Biomatik. HRV3C protease ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Jiejie Geng, et al.,
bioRxiv - Immunology 2021
Quote:
Forty human cytokines were detected by Quantibody® array kits (QAH-INF-3, RayBiotech) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...