-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
Burt M Sharp, Qin Jiang, Panjun Kim, Hao Chen,
bioRxiv - Neuroscience 2023
Quote:
... 2-(3-(4-chloro-3-fluorophenyl)-5-ethyl-1H-1,2,4-triazol-1-yl)-N-(3,5-di-chlorobenzyl)acetamide (MR-L2) was from Targetmol Chemicals ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Leena Putzeys, et al.,
bioRxiv - Microbiology 2022
Quote:
... 0.5% casein amino acids (LabM, Neogen), 2 mM MgSO4 ...
-
No products found
because this supplier's products are not listed.
Iuliia Polina, et al.,
bioRxiv - Cell Biology 2023
Quote:
... valproic acid (AmBeed, Arlington Heights, IL); (trifluoromethoxy)phenylhydrazone (FCCP ...
-
Cat# 24370-75-0,
Inquire
Ask
Micah Y. Belew, et al.,
bioRxiv - Neuroscience 2023
Quote:
Nicotinamide Riboside (NR) (BOC sciences cas no 1341-23-7) was supplemented as described in (35) ...
-
No products found
because this supplier's products are not listed.
Takuro Shimaya, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The streptavidin decoration of the cellulose membrane (Spectra/Por 7, Repligen, Waltham Massachusetts ...
-
No products found
because this supplier's products are not listed.
Andre Machado Xavier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a 7 ml dounce tissue grinder (DWK Life Sciences, 357542) as performed in Gosselin et al ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile agar base (Oxoid) supplemented with 7% defibrinated horse blood (HemoStat Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
Magnetofection
diificult to transfect cells
Cat# KC30400,
SilenceMag 200µL + PolyMag 100µL + PolyMag Neo 100µL+ CombiMag 100µL + Magnetic plate MF10000, USD $798.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Nuria Tubau-Juni, et al.,
bioRxiv - Immunology 2019
Quote:
... plates supplemented with 7% of Horse laked blood (Lampire Biological Laboratories, Pipersville, PA) and H ...
-
No products found
because this supplier's products are not listed.
Adriana Blazeski, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology) and cultured until 50-70% confluency prior to use in MVNs ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Aishan Zhao, et al.,
bioRxiv - Microbiology 2021
Quote:
... Trifluoroacetic acid (TFA) was purchased from Halocarbon (North Augusta, SC). Talon cobalt resin was from Clontech (Mountain View ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
In-Hyuk Jung, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 µg ml-1 human medium oxidized low density lipoprotein (oxLDL, #770202-7, Kalen biomedical) was used.
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Robert L. McPherson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or YCFAC medium (Yeast Casitone Fatty Acids Agar with Carbohydrates, Anaerobe Systems). Liquid cultures were established for each isolate through the inoculation of a single colony into 5-10 mL of media ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Periodic Acid-Schiff (PAS) Diastase Stain Kit (for polysaccharides staining) (ScyTek Laboratories), and Amyloid Stain Kit (Congo Red ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
Charles E. Norton, et al.,
bioRxiv - Physiology 2020
Quote:
... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Caleb K. Stubbs, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... after which medium was replaced with fresh medium containing with 7 nM Protective antigen (PA) alone (List Labs, #171E) or in the presence of 3 nM LFNRRSP/ LFNRRSPH4030A and incubated at indicated timepoints at 37°C in the presence of 5% CO2.
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Andrew V. Grassetti, Rufus Hards, Scott A. Gerber,
bioRxiv - Cell Biology 2021
Quote:
... lyophilized peptides were dissolved in 50% acetonitrile (ACN; Honeywell) / 2M lactic acid (Lee Biosolutions), incubated with 1.25 mg TiO2 microspheres (GL Sciences ...
-
No products found
because this supplier's products are not listed.
Angel K. Kongsomboonvech, et al.,
bioRxiv - Immunology 2020
Quote:
... Stable integrants were selected in media with 50 μg/ml of mycophenolic acid (Axxora) and 50 μg/ml of xanthine (Alfa Aesar ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Jie Zhang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 1% w/v deoxycholic acid (sodium salt)) supplemented with protease inhibitors (Bimake, Cat# B14001) followed by sonication ...
-
No products found
because this supplier's products are not listed.
Shikha Yadav, et al.,
bioRxiv - Cell Biology 2023
Quote:
Day 7 BMDMs were washed twice to remove traces of FCS and then incubated in starvation medium from Cell applications Inc ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...