-
No products found
because this supplier's products are not listed.
Katerina Cermakova, et al.,
bioRxiv - Systems Biology 2021
Quote:
... tert-butyl hydroperoxide (Sigma-Aldrich) served as a positive control for ROS ...
-
No products found
because this supplier's products are not listed.
Jordan W. Mundell, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and tert-butyl hydrogen peroxide (ThermoFisher) were used as standards for the extra- and intracellular assays ...
-
No products found
because this supplier's products are not listed.
Rafiquel Sarker, et al.,
bioRxiv - Physiology 2022
Quote:
... BPTU (1-(2-(2-(tert-butyl)phenoxy)pyridin-3-yl)-3-(4-(trifluoromethoxy) phenyl) urea was from Tocris Bioscience.
-
No products found
because this supplier's products are not listed.
Rafael M. Gandra, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-tert-butyl-1,4-benzoquinone (TBBQ; Cayman Chemical, Ann Arbor, MI), menadione (MND ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... methyl]-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine 4-amino-1-tert-butyl-3-(3-bromobenzyl)pyrazolo[3,4-d]pyrimidine (3BrB-PP1) (Abcam; ab143756) for 30 min ...
-
No products found
because this supplier's products are not listed.
Yusuke Ohno, et al.,
bioRxiv - Cell Biology 2023
Quote:
... We then added tert-butyl hydroperoxide (5.5 M in decane; Merck) dropwise for 1 min ...
-
No products found
because this supplier's products are not listed.
Amrita Sule, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Agnieszka Czarnocka-Cieciura, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
No products found
because this supplier's products are not listed.
John D. Sterrett, et al.,
bioRxiv - Systems Biology 2024
Quote:
... Baker methyl tert-butyl ether (MTBE) from VWR (Radnor, PA, USA), formic acid from ThermoFisher Scientific (Waltham ...
-
No products found
because this supplier's products are not listed.
Kun Wang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... lipid contents were extracted using the tert-butyl-methyl ether and methanol method47 from purified MBOAT7 proteins and lipid controls (Avanti Polar Lipids). Extracted lipids were resolubilized in 300 μL of isopropanol ...
-
No products found
because this supplier's products are not listed.
Pam S. Ellis, et al.,
bioRxiv - Cell Biology 2022
Quote:
Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
No products found
because this supplier's products are not listed.
Meng Shi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... hydrophobic interaction (Hitrap Butyl HP, GE Healthcare) and gel filtration (Superdex 200 Increase 10/300 ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Jamil Mahmud, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Somtochukwu S. Okafor, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 4-(3-butyl-1-imidazolio)-1-butanesulfonic acid triflate (Santa Cruz Biotechnology) was used as a gelation agent at concentrations 20 – 100 mg/mL ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Han Na Suh, et al.,
bioRxiv - Cell Biology 2021
Quote:
FACS sorted Tert- or Tert+ acinar cells were resuspended in Matrigel (BD 356231) for seeding ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Maria C. Sterrett, et al.,
bioRxiv - Genetics 2022
Quote:
... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
No products found
because this supplier's products are not listed.
Máté Kiss, et al.,
bioRxiv - Immunology 2020
Quote:
... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Methyl Methacrylate/Butyl Methacrylate (Electron Microscopy Sciences, Cat ...
-
No products found
because this supplier's products are not listed.
Magdalena Ambrożek-Latecka, et al.,
bioRxiv - Immunology 2023
Quote:
... HUVEC/TERT cells were transfected with pSELECT- hASC-GFP (InvivoGen) plasmid by electroporation as previously described [20] with slight modifications ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Natalia Duque-Wilckens, et al.,
bioRxiv - Immunology 2024
Quote:
... the medium was enriched with recombinant murine interleukin-3 (IL-3; 5 ng/mL) and stem cell factor (SCF; 5 ng/mL) from R&D Systems, Minneapolis ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Aniruddha Das, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A 3×5 mm2 craniotomy was drilled (Omnidrill35, World Precision Instruments) over an area covering the monocular and binocular primary visual (V1m and V1b ...
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.
-
No products found
because this supplier's products are not listed.
Michael H. Zhang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5 μg/mL of CD40 antibody ligand (clone: HM40-3; BioLegend).
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Clémentine Villeneuve, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5% CO2 on a 3 μm pore size cell culture insert (Corning) in DMEM supplemented with Glutamax ...
-
No products found
because this supplier's products are not listed.
Idoia Busnadiego, et al.,
bioRxiv - Immunology 2024
Quote:
... rabbit anti-pSer 14-3-3 Binding Motif (14-3-3 PBM) (#9601, Cell Signaling); rabbit anti-PLEKHG3 (PA5-46053 ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Han Na Suh, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The population of Tert+:Ki67+ was assessed by FACS (Gallios™ 561, Beckman Coulter).
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
Áron Kőszeghy, et al.,
bioRxiv - Neuroscience 2023
Quote:
3-5 months old male C57/BL6J mice (Charles River, UK) were anesthetized with isoflurane (4% induction ...
-
No products found
because this supplier's products are not listed.
Chen Qian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The UGT2B15 promoter 20 base-pair sequence (5’-TAACTTGATTGATTTTTCCT-3’ for wild type and 5’-TAACTTGGCTGTCTTTTCCT-3’ for mutant) was immobilized to a streptavidin SADH sensor chip (Sartorius) in running buffer (10 mM HEPES pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Mirushe H. Miftari, Bernt T. Walther,
bioRxiv - Developmental Biology 2022
Quote:
... embryos were paraffin-embedded and serially sectioned at 3-5 µm (Leica microtome), before attachment to poly-L-lysine-coated glass slides (Sigma ...
-
No products found
because this supplier's products are not listed.
J. Christopher Rounds, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sonicated for 3×5 minutes in a 4°C Bioruptor ultrasonicator (UCD-200, Diagenode), vortexed ...
-
No products found
because this supplier's products are not listed.
Jia Li, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and NEMO (excitation: 490 ± 5 nm; emission: 520 ± 5 nm) fluorescence were measured with a Flexstation 3 microplate reader (Molecular Devices, USA) controlled by SoftMax Pro v7.x ...
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Caroline S. Simon, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3-5% parasitemia) were purified using magnetic activated cell sorting (VarioMACS™ Separator, Miltenyi Biotec). Importantly ...
-
No products found
because this supplier's products are not listed.
Maria Chechik, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The most concentrated fraction was spun for 5 min at 13K rpm before applying 3 µL to UltraAuFoil R1.2/1.3 gold support grids (Quantifoil). Prior to sample applications grids were glow-discharged for 3 min in Pelco easiGlow glow-discharger (Pelco ...
-
No products found
because this supplier's products are not listed.
Jingu Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... A cerebral microinfarction was induced for 3-5 seconds by 561nm laser illumination with 60X objective lens (LUMFLN60XW, NA 1.1, Olympus) after intravenous injection of 100μl Rose Bengal (15mg/ml ...