Labshake search
Citations for PerkinElmer :
1 - 50 of 596 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Physiology 2021Quote: ... acylcarnitines were derivatized to their butyl esters and treated with the reagents of the NeoGram MSMS-AAAC kit (PerkinElmer). Their analysis was carried out on a Waters 2795/Quattro Micro AP liquid chromatography–tandem mass spectrometer (Waters ...
-
bioRxiv - Immunology 2022Quote: ... N/TERT-1C1C-EGFP cells were seeded in tissue culture-treated CellCarrier-96 Ultra Microplates (Perkin Elmer) and treated with the indicated stimuli in the presence of 3.3 µg/mL propidium iodide (PI) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 3’TAMRA fluorescence from 5’UAR was recorded by a single molecule avalanche photodiode (SPAD) (SPCM-AQR-14, PerkinElmer Optoelectronics, Quebec, Canada), through a 600/50 band pass emission filter ...
-
bioRxiv - Developmental Biology 2021Quote: ... cyanine 3 (PerkinElmer #NEL744E001KT), and cyanine 5 (PerkinElmer #NEL745E001KT) ...
-
SPNS1 is required for the transport of lysosphingolipids and lysoglycerophospholipids from lysosomesbioRxiv - Biochemistry 2022Quote: ... and lower phase (containing [3-3H]-sphingosine, [3-3H]-ceramides, [3-3H]-SM) were quantified by a scintillation counter (Perkin Elmer Tri-Carb Liquid Scintillation Analyzer).
-
bioRxiv - Biochemistry 2020Quote: ... 3 μL γ32P-dATP (Perkin Elmer), and 5 μL H2O for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... 3 pM GTP α-32P (PerkinElmer), 10 Units of VCE and incubated 30 min at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.5 ml Optiphase HISAFE 3 (PerkinElmer) was incubated with the filter overnight before liquid scintillation counting with MicroBeta JET (PerkinElmer) ...
-
bioRxiv - Genomics 2022Quote: ... and TSA Plus Cyanine 3 (PerkinElmer). After the last washing step ...
-
bioRxiv - Systems Biology 2024Quote: ... Finally 100 μl sample was added to scintillation vials containing 3 mls scintillant (OptiPhase HiSafe 3, Perkin Elmer). β-radioactivity was measured with Tri-Carb 4910TR liquid scintillation counter.
-
bioRxiv - Systems Biology 2020Quote: ... Cy3-TSA (3 min; Perkin Elmer NEL744001KT), Cy5-TSA (7 min ...
-
bioRxiv - Microbiology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Immunology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μL 35S-labeled methionine (PerkinElmer NEG709A500UC), 2.5 μL recombinant protein (~450ng ...
-
bioRxiv - Microbiology 2022Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Cell Biology 2024Quote: ... TSA Plus Cyanine 3 System (PerkinElmer NEL744001KT) was used to amplify signals generated using antibodies for RBPJ ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... The 14C bicarbonate stock solution (aqueous, activity 5 mCi/5 mL, PerkinElmer, Inc.) was diluted to a final specific activity of 5 µCi/50µL and added to the groundwater sample (43 mL ...
-
bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-D reconstruction was performed with Volocity (PerkinElmer).
-
bioRxiv - Cell Biology 2021Quote: ... TSA® Plus Cyanine 3 (PerkinElmer, 1:1,500) was used as a secondary fluorophore for Hbs1l-C2 probes.
-
bioRxiv - Immunology 2024Quote: ... mixed with OptiPhase HiSafe 3 scintillation fluid (PerkinElmer) and incubated for 16 hours at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cyanine 5 (PerkinElmer #NEL745E001KT). Sections were then incubated in 1X Trueblack Lipofuscin Autofluorescence Quencher (VWR #10119-144 ...
-
bioRxiv - Neuroscience 2022Quote: ... D-[5-3H(N)] (PerkinElmer). Cells were incubated for 4 and 6 h after which cell supernatants from duplicate plates were collected at each respective time-point and stored at −20 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer), and radioisotope activity was monitored by LSC-8000 β-scintillation (Hitachi) ...
-
bioRxiv - Neuroscience 2020Quote: ... then incubated in TSA plus cyanine 3 (Perkin Elmer) for 10 min ...