Labshake search
Citations for Bio-Rad :
1 - 50 of 1891 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... were chosen to be compatible with the Tert assay (Bio-Rad 2015). Two techniques were used ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Genomics 2020Quote: ... a HEX digital PCR assay for TERT was used (Bio-Rad, Hercules, USA), in which no BstUI recognition sequences were present.
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Immunology 2024Quote: ... the fractions were eluted with 0.25 M NaCl and biologically active fractions were further analyzed on a hydrophobic interaction column (Macro-Prep® t-Butyl HIC Resin, Bio-Rad 1580090). Three fractions eluted with buffers with pH=7 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies (Table 3) were diluted in 5% non-fat blocking milk (BioRad, Cressier, Switzerland) in TBST and incubated over night at 4°C with mild agitation ...
-
bioRxiv - Immunology 2024Quote: ... and copies of the housekeeping gene TERT (telomere reverse transcriptase) were measured in duplicate by droplet digital (dd)PCR (Bio-Rad QX100). A threshold of 3 HIV DNA copies/10,000 cells at the suppressed time point was set as a threshold for study inclusion ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... SARS-CoV2-PP were prepared by labelling with 0.4µM DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, or DID) (Thermo) with Biospin6 (Biorad) to remove residual dyes ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Microbiology 2022Quote: ... NS5B-FAM probe: 5’-ATGGGTTCGCATGGTCCTAATGACACAC-3’) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 μL reaction contained 500 ng of total RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were washed with TBS-T (3 x 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... 3-5 µL of cell suspension was then deposited on a 1.5% (w/v) low melting agarose (LMA; Bio-Rad) pad prepared using a gene frame positioned on a glass slide ...
-
bioRxiv - Molecular Biology 2024Quote: ... The blots were washed again after secondary antibody incubation and developed using either nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) for AP-conjugated secondary antibodies or the ECL substrate (BioRad) for the HRP labelled secondary antibody after incubating for about 10 to 15 mins at room temperature with gentle shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed with TBST 3 times for 5 minutes each before applying secondary fluorescent antibody (1:2,500, StarBright Blue 520 Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated in TBS-T/milk for 45 min and washed 3 × 5 min with TBS-T before detecting using a Chemidoc imager (Bio-Rad). NearIR-conjugated secondary antibodies (LI-COR Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Immunology 2022Quote: ... were amplified by PCR using 5’ and 3’ primers with overhangs containing T7 binding sites using iProof High-Fidelity Taq (Bio-Rad). PCR reaction products were run on an agarose gel to check for the correct amplicon ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were washed in 1X PBS with 0.1% Tween 3 times for 5 minutes each before scanning using the ChemiDoc™ MP Imaging System (Bio-Rad). Note ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times for 5 min with TBS and were subsequently incubated with Clarity Western ECL substrate working solution (Bio-Rad) for 5 min ...