Labshake search
Citations for GenScript :
401 - 450 of 1128 citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Cancer Biology 2023Quote: ... or vector containing full-length METTL7A or METTL7B with a C-terminus FLAG tag (all vectors from Genscript, Piscataway, NJ) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... NM_003755) with an N-terminal His6 tag was made by inserting DNA between NdeI and XhoI sites of pET15b (GenScript). pET15b-His6-eIF3g was used by GenScript to generate the deletion and substitution mutants.
-
bioRxiv - Biochemistry 2023Quote: ... vector encoding WT DosS CA (amino acids 454 – 578 of full-length DosS) sequence with an N-terminal 6xHis tag and a TEV protease site was purchased from GenScript. DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous papers.22 The forward and reverse primers (5’ to 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2023Quote: ... A recodonized version of full-length PfPK2 with at AvrII and StuI sites upstream of a loxP sequence in frame with GFP tag was custom synthesized as a G-block (Genscript). The resulting plasmid DNA construct (pSLI-PfPK2-loxP ...
-
bioRxiv - Biophysics 2023Quote: ... The chimera VnE-PRM-Prof with an N-terminal twinned-Strep-Tag (ST2) and PreScission-cleavage-site (ST2-(PreScission-cleavage-site)-VnE-PRM-Prof) was cloned by Genscript. The VnE-PRM-Prof chimera was designed to ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: The open reading sequences encoding TcdB1-GTD to TcdB8-GTD were synthesized with a C-terminal His6 tag and cloned into pET28a(+) by Genscript. Sequence length and strain information is shown in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids containing the gene of interest fused to an N-terminal His6 tag in the pet28A vector were obtained from Genscript and transformed into BL21-DE3 competent cells (New England Biolabs) ...
-
bioRxiv - Biochemistry 2024Quote: The gene encoding recombinant WT or mutant PLpro with an N-terminal Hisx6 tag was introduced into the bacterial expression vector pET-28b (+) by GenScript, Inc ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... Human CI-MPR cDNA (amino acids 1-2304) with C-tail HPC4 tag (EDQVDPRLIDGK) codon optimized for CHO expression was ordered from Genscript in pcDNA3.1 plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... corresponding to amino acids 53-463) fused to a C-terminal hexahistidine tag (two separate pET31a vectors) were purchased from Genscript (all inserts were codon optimized for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FAM134C (250-466aa) fused to a N-terminal GST-tag was gene synthesized by Genscript and cloned into a pGEX-4T1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of TEX264 (28-313aa) fused to a N-terminal GST-tag was gene synthesized by Genscript and cloned into a pGEX-4T1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of CCPG1 (1-212aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FKBP8 (1-391aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Biochemistry 2024Quote: ... a plasmid containing the target gene in the pet28A vector fused to an N-terminal His6 tag (twenty additional residues added) was acquired from Genscript and transformed into BL21-DE3 competent cells (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Cell Biology 2020Quote: ... TM27 and human IRE1α-TM were synthesized by Genscript. Genes corresponding to the transmembrane peptides with following amino acid sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... Human anti-SP IgG standards (chimera, GenScript, Piscataway, NJ) or human ACE-2 Fc (chimera ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lohse and a ORF human PTH1R (Genscript, cat.no. OHu15045D) was transfected into 293 cells ...
-
bioRxiv - Immunology 2023Quote: ... 50 µL of phycoerythrin (PE)-conjugated human ACE2 (Genscript) was added to each well and incubated for an additional 15 mins at 37°C with agitation ...
-
bioRxiv - Genetics 2023Quote: Genes were human codon-optimized and synthesized by Genscript, and plasmids were generated using a combination of restriction digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The human XIST oligo pool was ordered from GenScript and amplified as previously described to generate ssDNA biotinylated oligos (Engreitz et al. ...
-
bioRxiv - Biochemistry 2024Quote: Human MVP and PARP4 genes were synthesized by GenScript and subcloned into the pVL1393 baculovirus transfer vector ...
-
bioRxiv - Immunology 2024Quote: ... primary Ab goat anti-human IgG-HRP (GenScript Inc), and goat anti-human Kappa-HRP (SouthernBiotech ...
-
bioRxiv - Microbiology 2024Quote: ... Human STAT1 and IRF1 sgRNAs were purchased from GenScript. Two independent sgRNAs were used to generate CRISPR KO cell lines with the lentiviral system.
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Biochemistry 2021Quote: ... a GlySer-linker and the C-tag flanked by PmeI sites was amplified by PCR from a synthetic fragment provided by GenScript (USA), codon-optimized for expression in a low protease background C1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs encoding mCer-mCit sensor or CRONOS were synthesized and subcloned into pET28a vector containing His6 tag (Genscript, NJ, USA).
-
bioRxiv - Biochemistry 2021Quote: Mammalian expression plasmid pcDNA3.1+/C-(K)-DYK carrying the ORF sequence of WT CYP21A2 (NM_000500.7) with a C-terminal DYK (FLAG) tag was purchased from GenScript (New Jersey, USA). We used this plasmid as a template to create the variants through site-directed mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Microbiology 2024Quote: ... the wells were washed with PBST and incubated with HRP-conjugated Anti-HA tag antibody at 0.5 µg/ml (GenScript, Cat.#A01296) for 1 hour at room temperature ...