Labshake search
Citations for GenScript :
601 - 650 of 1128 citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G beads (Genscript, Nanjing, Jiangsu, China) were subsequently added to the mixtures and incubated for another 5 h ...
-
bioRxiv - Biochemistry 2023Quote: ... before incubation with Protein A Resin (Genscript, China) at room temperature for 2 h for antibody affinity purification ...
-
bioRxiv - Immunology 2022Quote: ... or S-protein peptide pool (Genscript, # RP30020, USA) or S-protein (B.1.351 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The eluted protein was cleaved with PreScission (GenScript) protease by dialysis and run over a second glutathione affinity column ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... The total natural IgM was purified from the flow through serum from Protein G resin using Protein L resin (GenScript, China).
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... oeANXA4: Human ANXA4 (NM_001320698.2) in pcDNA3.1+/C-(K)-DYK vector was purchased from GenScript (GenScript Biotech ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Cell Biology 2021Quote: ... Cas9 protein was purchased from Genscript (Cat. No. Z03389). Cas9 protein (12 µg ...
-
bioRxiv - Immunology 2022Quote: Plasmids encoding cDNAs of Pneumovirus proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector (30 ...
-
bioRxiv - Immunology 2022Quote: ... and protein G resin (L00209) were purchased from GenScript. Anti-NLRP3 (AG-20B-0014-C100 ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-fusion proteins were purified on glutathione resins (Genscript) as previously described (Arora ...
-
bioRxiv - Synthetic Biology 2023Quote: Synthetic genes encoding designed proteins were purchased from Genscript or Integrated DNA technologies (IDT ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteins were eluted with competitive DYKDDDDK peptide (Genscript, RP10586).
-
bioRxiv - Molecular Biology 2022Quote: ... was produced by GenScript Protein Expression and Purification Services (GenScript Corp, Piscataway, NJ). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein expression and purification were done commercially (Genscript)
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated on ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membrane (MERCK-Millipore) ...
-
bioRxiv - Plant Biology 2024Quote: ... and proteins were purified using Ni-NTA resin (GenScript). Proteins were subsequently refolded in a buffer containing 50 mM Tris-HCl ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... Human and hamster ACE2 (Q9BYF1.2 and GQ262794.1, respectively) were synthesized and cloned into pcDNA3.1+ (GenScript). All DNA constructs were verified by Sanger sequencing (ACGT) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type αSyn cDNA was optimized for expression in human cells and synthesized by Genscript before being cloned into a pcDNA5/FRT/TO/EGFP vector (kind gift from A.M ...
-
bioRxiv - Microbiology 2024Quote: ... LLC to a synthetic NINJ1 peptide comprising the first 76 aa of human NINJ1 (GenScript).
-
bioRxiv - Microbiology 2024Quote: ... The coding sequences of human Tollip and IFNGR1 were obtained from GenScript (catalog number OHU02397D) and Sino Biological (catalog number HG10338-CF) ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: Constructs encoding SARS-CoV-2 spike protein aa14-1213 and SARS-CoV spike protein aa14-1195 were synthesised commercially codon optimised for mammalian cell expression (Genscript and GeneArt, respectively). Residues 682-685 were mutated from RRAR to GSAS in SARS-CoV-2 S and R667A mutation was introduced in SARS-CoV S ...