Labshake search
Citations for GenScript :
401 - 450 of 468 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: A 96-well plate was coated overnight at 4ºC with 100 µL of a recombinant human ACE-2 fused to a Fc fragment (GenScript Laboratories, USA) at 1 µg/mL in carbonate buffer (pH 9.6) ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Genetics 2022Quote: ... PRDM9 (aa 1-416) and PRDM9dC (aa 1-371) were amplified from human cDNA purchased from GenScript (ORF Clone ID OHu03253). SETD2 (aa 1450-1645 ...
-
bioRxiv - Cell Biology 2024Quote: ... The human LEP mRNA sequence was sourced from the cDNA construct hLEP-pcDNA3.1(+)-C-(K)DYK (GenScript, clone ID OHu27387; NM_000230.3). Leptin-SBP-HaloTag plasmid was generated by inserting the WT LEP gene into the backbone derived from pMPx92 using restriction digest and Gibson assembly ...
-
bioRxiv - Microbiology 2024Quote: The viral segments of the human influenza virus A/Texas/37/2024 (H5N1, HPhTX) were synthesized in the genetic background of pUC57 (GenScript, USA). The synthesized sequences were designed according to the published sequences for the clinical HPhTX isolate with GenBank accession numbers PP577940-47 ...
-
bioRxiv - Biochemistry 2024Quote: ... The NACHO constructs for photo-crosslinking and flow cytometry experiments were sub-cloned from the cDNA construct of full-length human NACHO (Genscript, Ohu24486). Antibodies were either from commercial sources or were custom antibodies that have been described previously51 as detailed in Extended Data Table 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... ANS4-GFP and bEnd.3 cells were both treated with 100nM of 43gap 26 peptide (VCYDKSFPISHVR) (Genscript, catalogue # RP20274), every 8 hr for 24 hr ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Biochemistry 2024Quote: ... 3’ BamHI) SARS-Cov-2 N gene (Gene ID: 43740575) in pET-11a vector without any affinity tag (GenScript). pET-11a expression vector carrying SARS-Cov-2 N gene was transformed in BL21 (DE3 ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the transmembrane domains showing homology to previously known ACRs optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 50 nM human HER2:AF647 (Acro Biosystems) and 30 nM anti-VHH probe (MonoRab anti-Camelid VHH [iFluor 488], GenScript cat #A01862). The SARS-CoV-2 VHH strains were resuspended in saponin based stain buffer (1x PBS ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides containing the N-loop or the C-terminal sequence of human chemokines were designed and obtained (> 75% purity) from GenScript (Hong Kong). All peptides are biotinylated (biotin-Ahx ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Cell Biology 2021Quote: ... All SHIP164 (UHRF1BP1L) ORFs used in this study utilized a human codon optimized sequence designed and purchased from Genscript (sequence available upon request). The following constructs were kind gifts ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Immunology 2022Quote: Twenty 15-mer peptides (Figure 1A) used in human and mouse T-cell stimulation experiments were chemically synthesized by Genscript (TFA removal, >85% purity). The peptides were dissolved in DMSO at 20 mg/mL (∼12 mM) ...
-
bioRxiv - Immunology 2022Quote: ... The sequence of human IL-18BP (residues 1-194, UniProt ID: O95998) was purchased in the pUC57 vector at GenScript (GenScript, Piscataway, New Jersey, USA). The sequence was cloned in frame with a C-terminal caspase3 site followed by an AviTag and a His6 tag ...
-
bioRxiv - Microbiology 2022Quote: ... Immunizations were done on eight-to twelve-week-old H2L2 mice interperitoneally with 50-100 μg of a recombinant SARS-CoV2 Spike RBD319-591-Fc fusion protein generated from sequence from the original Wuhan seafood market pneumonia virus isolate (GenBank Accession# MN908947) and cloned in-frame into pcDNA vectors containing human IgG1 and mouse IgG2a Fc tags (GenScript USA Inc., Piscataway, NJ). Each mouse received a prime followed by 2 boosts ...