Labshake search
Citations for GenScript :
151 - 200 of 468 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Biochemistry 2024Quote: The human SRSF3-pET28a clone was purchased from Genscript (Piscataway, NJ). Different SRSF3 variants were subcloned in pET28a and expressed as TEV protease-cleavable N-terminal 6xHis-tag fusions in E.coli Rosetta2(DE3 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the primers g11S/g11AS covering target site sequence 11 (Figure 1A; Supplementary table 1) were synthesized by Genscript (www.genscript.com.cn) and combined by annealing ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Neuroscience 2024Quote: ... Urocortin 3 (Ucn3; GenScript USA, Piscataway, NJ: 60pmol/0.4μl/side) was dissolved in DMSO (10% v/v final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Cell Biology 2022Quote: ... human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA), full-length human NSF fused to His6 in pET28 was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... Human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA). The rabbit polyclonal anti-CSP antibody (affinity-purified with the immunogen directed towards the amino acids 182-198 of rat CSP) ...
-
bioRxiv - Immunology 2022Quote: Residues 18-615 of human ACE2 (UniProtKB - Q9BYF1) were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Codon-optimized cDNAs for human SLC1A2 and SLC1A3 were obtained from Genscript and cloned in pTO vector with or without a N-terminal Strep-HA tag.
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog #: OHu03021D). The human FLAG-tagged EMC5 plasmid (catalog # ...
-
bioRxiv - Microbiology 2020Quote: ... The human ACE2 (residue 19-615, GenBank: NM_021804.2) was synthesized by Genscript and cloned into VRC8400 with a N-terminal Kozak consensus sequence and signal peptide and with a C-terminal octa-histidine tag.
-
bioRxiv - Biochemistry 2021Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... the full-length cDNA of human McIdas was obtained by GenScript (OHu00715) and cloned with an N-terminal GFP tag into the EcoRI/XhoI restriction sites of the pENTR1AminusCmR vector ...
-
bioRxiv - Microbiology 2020Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human pre-pro-OCN cDNA cloned into pcDNA3 was purchased from GenScript. Each construct was used as PCR template for amplification and to introduce EcoRI and AgeI cloning sites and cloned in pIRES2-EGFP-V5 plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Site-directed mutagenesis to create human KCNH2 variants was completed by Genscript Biotech (Piscataway ...
-
bioRxiv - Immunology 2020Quote: The cDNA of the human CR3022 Fab fragment was synthesized by GenScript based on its previously reported sequence (31) ...
-
bioRxiv - Molecular Biology 2022Quote: The cDNA encoding wildtype human MRP4 was obtained from GenScript (CloneID: OHu17173) and cloned into a donor plasmid based on the pHTBV1.1 vector73 to generate a construct featuring full-length MRP4 with a C-terminal HRV 3C-cleavable mVenus-tag linked in tandem to a Twin-Strep-tag and a 6xHis-tag ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human NRP1 (HNPR1) cloned into pCS2+ was purchased from GenScript (Piscataway, NJ). All expression constructs were confirmed by sequencing and Western blot analysis (see below) ...
-
bioRxiv - Biophysics 2022Quote: ... Human TRPV4 constructs in a pcDNA3.1 vector were commercially obtained from GenScript. Expression plasmids encoding for the isolated intrinsically disordered region (IDR) ...
-
bioRxiv - Cell Biology 2024Quote: ... and human Flag-TMX2 (pIRES2-EGFP) were constructed by Genscript (Piscataway, NJ). Dog Flag-Calnexin was previously described (Lynes et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... A version of the LdNT3 stem-loop was synthesized with flanking BstXI and PCR primer binding sites (Genscript, Piscataway, NJ) and inserted into the BstXI sites of the modified pRP vector.
-
bioRxiv - Microbiology 2023Quote: ... The hygromycin resistance gene was amplified from the pLew90 vector [60] (primers p39/p40) and puromycin resistance gene from a codon-optimized puromycin gene in a vector synthesized by GenScript as previously described (primers p41/p42 ...
-
bioRxiv - Systems Biology 2022Quote: ... Primer and probes (see below in Table S1) were designed using Real-time PCR (TaqMan) Primer and Probes Design Tool (online tool) from GenScript and synthesized by BioTez ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by PCR using primers 1941 and 1942 and as a template the clone in PD912-GAP which was obtained from Genscript, Piscataway ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... Cdc42 and WAS-GBD were human codon-optimized and gene-synthesized by Genscript and inserted into the pCAGGS plasmid using an NEBuilder assembly kit ...
-
bioRxiv - Biophysics 2024Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cloning: Human KRAS-4B ORF (NCBI Reference Sequence NP_004976.2) was synthesized by GenScript and cloned into pUC57 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then transfected with 3 μg of CXCR3A plasmids (GenScript, OHU18425C) or CXCR3B expression construct (GenScript ...