Labshake search
Citations for GenScript :
51 - 100 of 468 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... The primers used in this study were synthesized by GenScript (GenScript, China). The primers are listed in Supplementary Table 2.
-
bioRxiv - Microbiology 2022Quote: ... All primers were supplied by IDT and reporters were supplied by GenScript.
-
bioRxiv - Genetics 2024Quote: ... FAM-labeled and unlabeled primers were synthesized by GenScript (Nanjing, Jiangsu, China). For the DNA EMSA ...
-
bioRxiv - Microbiology 2024Quote: Human codon-optimized cDNA (Genscript, USA) encoding the NA ectodomains of A/Wisconsin/09/2013 (H1N1 ...
-
bioRxiv - Microbiology 2024Quote: ... Human codon-optimized cDNA (Genscript, USA) encoding these regions was cloned into pCAGGS expression plasmids containing the human IgG1 heavy chain and Ig kappa light chain constant regions.55 Recombinant hIgG1 12F5 ...
-
bioRxiv - Biochemistry 2024Quote: Human mAC genes were from GenScript and fitted with a C-terminal FLAG-tag ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Biophysics 2023Quote: ... FRET-labeled 207 bp DNA was prepared by PCR using labeled primers (GenScript) ATCGGACCC/iCy5N/ATACGCGGCC (forward primer) ...
-
bioRxiv - Cell Biology 2024Quote: ... amplified from a synthetic sequence ordered from Genscript (primers PCR4_ARKx _F/PCR4_ARKx _R). Primer sequences are listed in Table S1.
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Detection of the captured human IgGs was performed with mouse anti-human IgG Fab-HRP (Genscript, Piscataway, NJ, USA) (1:5000 dilution in PBS 0.1 % casein) ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Microbiology 2022Quote: ... All the primers used in this study were synthesised by GenScript (GenScript, Nanjing, China) and BioSune (Biosune ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was gene-synthesized (by Genscript) and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Neuroscience 2024Quote: ... Purified human GST-PABPN1 was obtained from GenScript.
-
bioRxiv - Biochemistry 2024Quote: ... The human S100A9 gene was purchased from Genscript (Clone ID ...
-
bioRxiv - Biophysics 2024Quote: ... and human LRRC8a (hLRRC8a: 56262) were synthesized (GenScript) and subcloned using a standard molecular cloning techniques into pIE2 vector for transient expression in HEK cells ...
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Immunology 2024Quote: ... The the mouse immunoglobulin heavy- and light-chain genes (VH/VL) were cloned into pcDNA3.1 in-frame with human IgG1 and human kappa chain backbone (Genscript, New Jersey). Equal amounts of heavy- and light-chain plasmids were transfected into Expi293 cells using ExpiFectamine293™ transfection reagents (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Cell Biology 2020Quote: ... TM27 and human IRE1α-TM were synthesized by Genscript. Genes corresponding to the transmembrane peptides with following amino acid sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... Human anti-SP IgG standards (chimera, GenScript, Piscataway, NJ) or human ACE-2 Fc (chimera ...
-
bioRxiv - Immunology 2023Quote: ... 50 µL of phycoerythrin (PE)-conjugated human ACE2 (Genscript) was added to each well and incubated for an additional 15 mins at 37°C with agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The human XIST oligo pool was ordered from GenScript and amplified as previously described to generate ssDNA biotinylated oligos (Engreitz et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lohse and a ORF human PTH1R (Genscript, cat.no. OHu15045D) was transfected into 293 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... we outsourced purified recombinant human RHINO protein from GenScript. Rhno1 cDNA with N-terminal 6xHIS tag and TEV cleavage sequence was cloned into a pET30a vector and expressed in E ...
-
bioRxiv - Genetics 2023Quote: Genes were human codon-optimized and synthesized by Genscript, and plasmids were generated using a combination of restriction digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Immunology 2024Quote: ... primary Ab goat anti-human IgG-HRP (GenScript Inc), and goat anti-human Kappa-HRP (SouthernBiotech ...
-
bioRxiv - Microbiology 2024Quote: ... Human STAT1 and IRF1 sgRNAs were purchased from GenScript. Two independent sgRNAs were used to generate CRISPR KO cell lines with the lentiviral system.
-
bioRxiv - Biochemistry 2024Quote: Human MVP and PARP4 genes were synthesized by GenScript and subcloned into the pVL1393 baculovirus transfer vector ...
-
bioRxiv - Biochemistry 2021Quote: ... A 30-mer oligoribonucleotide template and a 20-mer oligoribonucleotide primer were chemically synthesized by GenScript. The template and primer oligoribonucleotides were annealed by heating the solution to 95 °C and gradually cooling to 4 °C ...