Labshake search
Citations for GenScript :
251 - 300 of 688 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were separated by SDS-PAGE on 4-12% gradient gels (ExpressPlus, Genscript, New Jersey, NJ, USA). Each gel lane was cut into 6 equal slices ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were separated by SDS-PAGE on 4–20% Tris-Glycine or SDS-MOPS gradient gels (GenScript, USA) and transferred onto PVDF membranes (Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Cell Biology 2022Quote: 15 to 30 µg of total protein samples were resolved on ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... following the manufacturer’s instructions and protein samples were loaded on gradient 4-20% Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and PdCoV0081-4 ( Accession # MW685622.1, aa1-1092 with E854P and V855P mutations) were synthesized and cloned into pCDNA3.1- vectors (Genscript) with the following C-terminal modifications ...
-
Chemical Stabilization of the HIV-1 Capsid Results in Efficient HIV-1 Reverse Transcription in vitrobioRxiv - Microbiology 2020Quote: ... 15 μl volumes of the gradient fractions were separated by electrophoresis on precast 4-20% polyacrylamide gels (Genscript). The proteins were transferred to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral vector encoding CD19 specific CAR (CD19-CD8-4-1BB-CD3z) was designed and synthesized by GenScript. The envelope pCMV-VSV-G plasmid (from Bob Weinberg (Addgene #8454 ...
-
bioRxiv - Neuroscience 2024Quote: ... Equal amounts of 10 μg protein lysate were loaded and separated on a 4-12% SurePAGETM gel (GenScript) and transferred to a polyvinylidene difluoride membrane (Millipore) ...
-
bioRxiv - Immunology 2024Quote: ... the samples were cooled and loaded onto a SurePAGE Bis-Tris 4-12% gel (GenScript, Piscataway, NJ, USA) with Protein Precision Plus dual color ladder (Bio-Rad laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was quenched by SDS sample buffer and analyzed by 4-20% SDS-gel (GenScript, Piscataway, NJ, US). Fluorescent ubiquitin signals were imaged using Thermo iBright exposed for 750 ms.
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were recovered and 20 μg protein were separated on SurePAGE Bis-Tris 4-12% gradient gel following the manufacturer’s instructions (Genscript). A protein standards ladder (BioRad #1610374 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Biochemistry 2024Quote: Codon-optimized RdRp and VPg genes of HuNoV GII.4 Sydney strain (GenBank: AFV08794.1) were synthesized and cloned in the pET28a vector for bacterial expression by Genscript U.S.A ...
-
bioRxiv - Microbiology 2024Quote: Supernatants and eluted samples were run on 4-12% SurePAGE™ Bis-Tris Gels (M00652, M00653, or M00654, GenScript), followed by wet transfer to Immobilon-P polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... (NM_005855.4, H-pSL056), RAMP2 (NM_005854.3, H-pSL042) and RAMP3 (NM_005856.3, H-pSL043) were purchased from Genscript (Piscataway, NJ, USA). The DNA construct of the calcitonin receptor C-terminally fused with NanoLuc luciferase [22] (Nluc_FL_CTR (H-pSL054) ...
-
bioRxiv - Cell Biology 2024Quote: ... UK). AFF3ir-ORF2 (Cat. No. C0302HL300-4) and AFF3ir-ORF1 (Cat. No. C0302HL300) antibodies were from GenScript (NJ, USA). GAPDH (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Immunology 2021Quote: ... The plate were then washed with PBS once and then 200,000 splenocytes were added to each well and stimulated for 24 Hrs at 37°C in 5% CO2 with pool of 12-mer peptides (GenScript) at a concentration of 5.0 μg/well spanning the entire SARS-CoV-2 S protein along with Negative control (RPMI 1640 supplemented with 10% FBS and 1X antibiotic and positive control (Concanavalin A ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (nominally 50 μg) from each sample were separated on 4-20% gradient Bis-Tris SDS-PAGE gels (GenScript), and protein was then electroblotted onto low autofluorescence PVDF membrane (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... Monomeric αSyn and αSyn oligomers were then resolved by SDS-Page into a gradient 4-20% SDS-Page gel (GenScript) and transferred to polyvinylidenedifluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... RNA-sequencing was applied to confirm the full-length JURV genome (10,993 bp) as previously described.4 Infectious JURV was recovered from a full-length cDNA clone (Genscript, USA) comprising genes encoding for the nucleoprotein (JURV-N) ...
-
The activator domain of bacterial collagenases drives collagen recognition, unwinding and processingbioRxiv - Biochemistry 2023Quote: The coding sequences of V-B from Scl2.28 incorporating the 4 mutated tripeptides and the coding sequence of the V domain from Scl2.3 were purchased from Genscript (Germany). The modified coding sequence of V-B was cloned into a modified pET15b vector ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Immunology 2024Quote: ... with pGS-CMAS-Neo plasmid with sgRNA targeting exon 4 of CMAS with CCATCCCAGTCTTGTCGACG gRNA from a U6 promoter and a neomycin-resistance marker (GenScript). Clonal A549 CMAS-deficient cell lines were established by limiting dilution after selection with 800 μg/mL G418 (GeneticinTM ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...