Labshake search
Citations for GenScript :
51 - 100 of 688 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the slices were incubated overnight at 4°C with rabbit polyclonal anti-AQP4 (GenScript Biotech, Piscataway, NJ, USA) diluted 1:2000 in the blocking buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant obtained after centrifugation of lysate for 20 min at 10,000 rpm at 4°C was loaded onto anti-DYKDDDDK G1 affinity resin (GenScript) equilibrated with buffer A ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Gametocyte extract and 230CMB 21 samples were mixed with 4× NuPAGE™ LDS sample buffer and heated for 10 minutes at 70°C before loading on a 4–20% Bis-Tris gel (GenScript). 20 ng 230CMB was loaded per well and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ GCA GTG CTC CAA AGC GGA TTT CGC 3’) of mSca-containing DuProSense with PLpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ CTG AAA GGC GGC GCG CCG ACC AAA 3’) of mSca-containing DuProSense with Mpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... and eluted with 3 x Flag peptide (GenScript, RP21087), concentrated using an Amicon™ Ultra-4 centrifugal filter (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Microbiology 2021Quote: ... heated for 8 minutes at 95°C and run on a precast 4-12% Bis-Tris PAGE gel (Genscript, Cat# M00654). Protein was transferred to a nitrocellulose (NC ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Biochemistry 2024Quote: ... CRISPR/Cas9 engineered HEK-293 cell lines (uS-4-Flag, uS-13-Flag, and uL-4-HA tagged HEK-293 cells, Genscript) were treated as HEK T-RExTM-293 cells ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal amount of total protein (typically 20 or 30 µg/sample) were separated either on 4-12% or 4-20% SurePAGE Bis-Tris gels (Genscript) and transferred on nitrocellulose membrane (Merck Millipore ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were heated for 10 min at 100°C and were then loaded on an SDS gradient gel (4–20% Precast Protein Improve Gels, Genscript Biotech Corporation). The gel was run for 120 min at 120 V ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Microbiology 2020Quote: ... Fragment 4 was ordered as synthetic sequence (GenScript) with the first 274 bp recodonised and was amplified from plasmid pUC57-re-ap2-hc-1 using primers ap2-hc-5'_HR2_re_F and ap2-hc-5'_HR2_re_R.
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Developmental Biology 2023Quote: ... then 4 × LDS sample buffer (GenScript, M00676-10) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...