Labshake search
Citations for GenScript :
201 - 250 of 634 citations for GPN loop GTPase 3 GPN3 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and monoclonal antibody (clone ID: 6D11F2) were from GenScript® ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... with MonoRab™ Rabbit Anti-Camelid VHH Antibody (GenScript) diluted 1:250 in coating buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Antibodies were custom-made by GenScript (New Jersey, USA), using the sequences provided in the Supplementary source data.
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep-tag antibody (Genscript #A01732, ; 1:2,000 dilution), anti-FLAG-tag antibody (Sigma #F1804 ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with a α-HIS antibody (Genscript A00186), followed by HRP-conjugated α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Microbiology 2024Quote: ... A custom primary antibody for Imp1 (α-Imp1, Genscript), a commercial primary FLAG antibody (α-FLAG ...
-
bioRxiv - Genomics 2024Quote: ... The polyclonal antibody was purified by affinity column (GenScript). No cross reactivity against the host cell lysates was seen by western blots (Supplementary figure 13B) ...
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...
-
bioRxiv - Plant Biology 2022Quote: ... using anti-StTGA2.1 antibodies (diluted 1:4.000, GenScript, USA). Additionally ...
-
bioRxiv - Molecular Biology 2022Quote: ... MonoRabTM HRP Rabbit anti-Camelid VHH antibody (GenScript #A01861) was used to detect vhhGFP fusion proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Microbiology 2024Quote: The recombinant antibody development workflow was conducted by Genscript Biotech (Piscataway ...
-
bioRxiv - Microbiology 2024Quote: ... A rabbit IgG anti-Avi polyclonal antibody from Genscript was used at a dilution of 1:3000 in combination with a goat anti-Rabbit IgG-HRP monoclonal antibody at 1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with mouse α-HIS antibody (Genscript A00186). Proteins were detected using HRP-conjugated goat α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Biochemistry 2024Quote: ... CBP (Mouse; GenScript CBP Tag Antibody cat. No. A01798), Rpt1 (Abcam Aβ22678) ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Microbiology 2022Quote: ... Heterologous expression was detected by electroblotting SDS-PAGE Tris-glycine gels onto nitrocellulose membranes and immunostaining with primary rabbit anti-His-tag antibody and secondary goat anti-rabbit IgG phosphatase alkaline conjugated antibody (GenScript, Piscataway, NJ, USA) (Suppl ...
-
bioRxiv - Biophysics 2024Quote: The S-S309 antigen-antibody antibody complexes were electrophoresed on the 4-12% SurePAGE™ Bis-Tris gel (Genscript Biotech Corporation, Jiangsu, China). The proteins were visualized by One-Step Blue Stain (Biotium ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...