Labshake search
Citations for GenScript :
251 - 300 of 634 citations for GPN loop GTPase 3 GPN3 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Neuroscience 2021Quote: We used the following primary antibodies: NEEP21/NSG1 (Genscript A01442), FAM21 (Millipore ABT79) ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit anti-PknG antibody was produced and purified by GenScript Biotechnology with the recombinant GST-tagged PknG protein as immunogen (1/10000 for immunoblotting ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Microbiology 2020Quote: A custom polyclonal anti-KH antibody was generated by GenScript, using their 49-day antibody generation protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The polyclonal primary antibody anti-Orco was purchased from Genscript and designed against the peptide sequence SSIPVEIPRLPIKSFYPW in the second extracellular loop (ECL2) ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 dilution overnight at 4 °C with gentle rocking ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 10 nM biotinylated antibody (mouse anti-FLAG, GenScript). Chambers were flushed to remove reagents ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Evolutionary Biology 2024Quote: The rabbit antibody for Shavenbaby (Svb) was produced by GenScript against the following amino acid sequence:
-
bioRxiv - Immunology 2023Quote: ... THETM V5 Tag antibody (both at 1:5000 dilution, GenScript), and CLIPA8 primary antibody (1:5000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: Anti-Miranda polyclonal antibody was generated by Genscript (https://www.genscript.com/). The epitope used for immunization is ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy and light chain genes were synthesized by GenScript, separately inserted into vector plasmids (pCMV3-CH ...
-
bioRxiv - Evolutionary Biology 2024Quote: A custom anti-VGLL3 polyclonal antibody was procured from Genscript with delivery in January 2020 as follows ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... and anti-Cas9 antibody (Clone 4A1) were purchased from Genscript. All DNA oligos were purchased from Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and polyclonal αcGAS antibodies were purified by antigen affinity (GenScript). Serum was used at 1:30,000 for cGAS detection ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 were used ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273).
-
bioRxiv - Immunology 2024Quote: ... Incubation with the primary antibody (rabbit anti-CxVLG-1 (GenScript) generated in [26] ...
-
bioRxiv - Plant Biology 2024Quote: ... All custom antibodies were produced by GenScript (Piscataway, NJ, USA). Secondary detection used a fluorescent goat anti-rabbit antibody (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were probed with custom-made anti-Hcp antibodies (GenScript; polyclonal antibodies raised in rabbits against the peptide DPQSGQPAGQRVHKC) ...
-
bioRxiv - Neuroscience 2024Quote: Mouse monoclonal tau antibody 8B2 IgG1κ was generated by GenScript as previously described by immunizing BALB/c mice with a peptide encompassing to pSer396/404 region of the tau protein that was conjugated to keyhole limpet hemocyanin via a cysteine residue (cTDHGAEIVYK(pS)PVVSGDT(pS)PRHL ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273).
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of METTL8 in stably-infected cell lines were characterized by immunoblotting with the anti-Strep antibody (THETM NWSHPQFEK antibody, Genscript, cat. No. A01732, 1:1000 dilution). Transient transfections of TWIN-Strep and FLAG-tagged proteins were also loaded onto BOLT 4–12% Bis-Tris gels ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
bioRxiv - Plant Biology 2020Quote: Custom affinity-purified polyclonal anti-UCC1 antibodies were produced by Genscript, USA and were used as a primary antibody ...
-
bioRxiv - Microbiology 2020Quote: ... Custom primary peptide antibody generated in rabbits against ICP1 capsid (GenScript) was diluted 1:1500 and applied to the membrane for more than three hours ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... VHH-huFc antibodies identified from screening were commercially obtained from GenScript.
-
bioRxiv - Genomics 2021Quote: ... The following antibodies were used: Gcn5 (rabbit polyclonal, 1:1000, (GenScript antibody services ...
-
bioRxiv - Microbiology 2023Quote: ... Biotinylated anti-VHH monoRab monoclonal antibody (Genscript, catalogue number A01995-200) was captured at a concentration of 0.1 μg/mL (10 ng/well in 0.1 mL ...
-
bioRxiv - Biochemistry 2023Quote: ... a rabbit anti-Strep-tag IgG antibody (Genscript, Piscataway, NJ, USA) and a goat anti-rabbit IgG Alexa 488 conjugate as secondary antibody were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were anti-strep tag (GenScript, A01732, 1/1000), anti-PHF21A (in house ...
-
bioRxiv - Biochemistry 2022Quote: ... All primary antibodies were tailor-made by GenScript (New Jersey, USA) with sequences found in Supplementary Table 7.
-
bioRxiv - Plant Biology 2022Quote: ... and used it to raise a polyclonal antibody in rabbit (Genscript). Anti-AtSMC3 and anti-GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2023Quote: The anti-phospho BRCA1 antibody was raised and purified by GenScript against phosphorylated peptide CQSESQGVGL{pSer}DKEL.
-
bioRxiv - Microbiology 2024Quote: ... The anti-His antibody was obtained from (Genscript, catalog number A00186).
-
bioRxiv - Microbiology 2024Quote: ... The anti-strep (#A00626) antibody was purchased from GenScript (Nanjing, China). The anti-MAVS (#sc-166583 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was incubated with FLAG-antibody-coated beads (Genscript, L00432) and washed with wash buffer (50 mM HEPES/NaOH ...
-
bioRxiv - Biochemistry 2024Quote: The custom-produced rabbit anti-RDD antibody was ordered from Genscript INC as described in our previous work [9].
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...