Labshake search
Citations for GenScript :
1 - 50 of 634 citations for GPN loop GTPase 3 GPN3 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Biochemistry 2022Quote: ... GST-tagged GTPases were purified on high affinity GST resin (GenScript). The GST-tags were removed by PreScission protease and separated from the GTPase by a further gel filtration column ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Biochemistry 2024Quote: ... Biotin-labeled stem peptides (GenScript) at 4 μg/mL in 1× kinetics buffer (1× PBS ...
-
bioRxiv - Immunology 2024Quote: ... The biotin-K417N peptide (VRQIAPGQTGNIADYNYKLP ; GenScript) was mixed with the streptavidin-AF647 in a 4:1 ratio at room temperature for 2 hours ...
-
bioRxiv - Microbiology 2024Quote: ... The pilA ACICU negative and αβ-loop mutants (sequences available in Supplementary Table 1) were synthesized by Genscript and ligated into pUCP20GM (33 ...
-
bioRxiv - Immunology 2020Quote: ... Biotin-Protein L was purchased from GenScript. BsiWI was purchased from New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... A version of the LdNT3 stem-loop was synthesized with flanking BstXI and PCR primer binding sites (Genscript, Piscataway, NJ) and inserted into the BstXI sites of the modified pRP vector.
-
bioRxiv - Cell Biology 2022Quote: ... was inserted between Lys359 and Met360 in the TM3-TM4 intracellular loop of the β2 subunit by using the GenBuilder cloning kit (GenScript, catalog #: L00701). The construction of fluorescently tagged nAChR subunits were described previously [58 ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides containing the N-loop or the C-terminal sequence of human chemokines were designed and obtained (> 75% purity) from GenScript (Hong Kong). All peptides are biotinylated (biotin-Ahx ...
-
bioRxiv - Cell Biology 2023Quote: ... was inserted between Lys359 and Met360 in the TM3-TM4 intracellular loop of the β2 subunit by using the GenBuilder cloning kit (GenScript, catalog #: L00701), as previously described 17 ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2024Quote: H3K9Me2K14Ac-Biotin (aa 1-19) peptide was purchased from Genscript. The countersalts are hydrochloric salts ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides containing an N-terminal biotin tag were purchased from GenScript and dissolved according to manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2024Quote: ... an N-terminally biotinylated PbpCaa1-13 peptide (Biotin-Ahx-MNDWTLPPYKFDD; GenScript, USA) was immobilized on the sensor ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Immunology 2024Quote: ... Fine epitope mapping was performed by ordering synthetic peptides with N-terminal biotin residues (Genscript: 17-mer YHHHHHHDYDIPTTENL ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2mg/ml BSA with either fixed or varying concentrations of either the peptide substrate (Biotin-GGGENWYNTLKRKK-NH2) (Genscript) or ATP spiked with 0.8μCi [γ 32P]-ATP (Perkin Elmer) ...
-
bioRxiv - Microbiology 2022Quote: ... Peptides were commercially synthesized and biotin-labeled on the N-terminus using Fmoc chemistry (GenScript, Piscataway, NJ, USA). Sequences of these peptides are shown in Table 1.
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: 1 µg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized fom Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Immunology 2021Quote: ... 1 μg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized from Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Biochemistry 2022Quote: Substrate phosphorylation time course assays with PKD1ULD-5G/10G-KD were performed on ice with 50 nM protein and 100 µM biotinylated Syntide2 (biotin-PLARTSVAG (GenScript)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The blot was incubated with 10 μg/mL pre-biotin-CpOGACD for 1 h at room temperature followed by incubation with streptavidin-HRP (1:5000, M00091, GenScript) for 30 min.
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Immunology 2023Quote: ... The biotinylated SARS-CoV-2 fusion peptide (N’-biotin-DPSKPSKRSFIEDLLFNKVT-C’) and His-tagged HIV Env MPER peptide (N’-NWFDITNWLWYIKSGGSHHHHHHHH-C’) were chemically synthesized by GenScript.
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ GCA GTG CTC CAA AGC GGA TTT CGC 3’) of mSca-containing DuProSense with PLpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ CTG AAA GGC GGC GCG CCG ACC AAA 3’) of mSca-containing DuProSense with Mpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Immunology 2020Quote: ... UK) and CAR combinations with anti-CD19(fmc63) scFv were assessed by staining with Protein-L (Biotin-Protein L, GenScript, Piscataway, NJ, USA). In both cases ...