Labshake search
Citations for GenScript :
1301 - 1350 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... gene fragments (GenScript) encoding the transposase (TnpA ...
-
bioRxiv - Molecular Biology 2023Quote: ... gene fragments (Genscript) of ωRNA encoded downstream of T7 promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli (GenScript) and cloned into pET28-Sumo3 vector (EMBL ...
-
bioRxiv - Cell Biology 2023Quote: ... Blots were developed using the Lumi Sensor Chemiluminescent HRP Substrate kit (Genscript, United States) and SuperRX Fuji medical X-Ray films (Fuji FILM ...
-
bioRxiv - Cell Biology 2023Quote: ... pmCherry-N1-VAMP3 S48E pmCherry-N1-VAMP3 S48A and pEGFP-N1-WDFY2 (human) were generated as synthetic constructs (Genscript).
-
bioRxiv - Cell Biology 2023Quote: ... The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript. The sequences of the constructs are provided in the supplementary documentation.
-
bioRxiv - Biochemistry 2023Quote: ... The gene encoding for the GAF2 domain from All1280 of Nostoc PCC 7120 (NCBI protein ID BAB73237.1, UniProtKB Q8YXD3, amino acids 562-727) was ordered from Genscript (codon optimized for E. coli) in the pUC18 cloning vector ...
-
bioRxiv - Biochemistry 2023Quote: ... The pET28-GAF3 plasmid (ordered from Genscript) was constructed using the gene Slr1393 of Synechocystis PCC 6803 (NCBI protein ID BAA17210 ...
-
bioRxiv - Biophysics 2023Quote: ... The chimera VnE-PRM-Prof with an N-terminal twinned-Strep-Tag (ST2) and PreScission-cleavage-site (ST2-(PreScission-cleavage-site)-VnE-PRM-Prof) was cloned by Genscript. The VnE-PRM-Prof chimera was designed to ...
-
bioRxiv - Cell Biology 2023Quote: Coding sequences for each annotated M6 isoform (FlyBase) were synthesized (GenScript) with a 5’ EcoRI site and 3’ (GGS)5 linker and NotI site ...
-
bioRxiv - Cell Biology 2023Quote: ... and RSPH22 (OHu31347, GenScript) was subcloned into phCMV3 to express human RSPH proteins tagged with FLAG at C-termini ...
-
bioRxiv - Biophysics 2023Quote: ... cerevisiae, synthesized, and cloned into vector V08 (Khan et al., 2018) by Genscript (Piscataway, NJ, USA). See Table S1 for all full-length protein sequences.
-
bioRxiv - Biochemistry 2023Quote: ... -PA and pCI-NP plasmids were described previously.73,74 The pFluPol-HA-mCherry plasmid was generated by replacing the internal sequence of the pFluPol-HA plasmid of the WSN reverse genetic system75 in between 125 nucleotides from the 5’end and 77 nucleotides from the 3’end by mCherry through standard PCR cloning followed by deletion of ATGs in the HA open-reading frame by an adapted site-directed mutagenesis protocol as described previously.74 The coding sequence of huANP32 was generated by gene synthesis (GenScript Biotech) and cloned into the pCI vector by standard PCR cloning ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (GenScript, New Jersey, USA). Human ANP32a was over expressed using plasmid pQTEV-ANP32a ...
-
bioRxiv - Microbiology 2023Quote: ... gH was detected using custom-made polyclonal rabbit antibodies raised against peptides derived from KSHV gH (Genscript).
-
bioRxiv - Biochemistry 2023Quote: ... and cloned into pUC57 (GenScript). Each sequence was expressed in vitro using the PURExpress® In Vitro Protein Synthesis Kit as described above (Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... and cloned into pUC57 (GenScript, Piscataway, NJ).
-
bioRxiv - Plant Biology 2023Quote: ... was custom synthesized by GenScript (Piscataway, NJ). nATP1 was cloned downstream of an enhanced CaMV 35S promoter and introduced into plant expression vector pCAMBIA1300 (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were loaded on Bis-Tris gradient gels (4-20%, Genscript) and run using Tris-MOPS buffer at 60 mA/200 V ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: A codon optimised DNA encoding human USP28 was procured from Genscript and cloned between the NdeI/BamHI multiple cloning site (MCS ...
-
bioRxiv - Microbiology 2023Quote: Custom polyclonal antibodies specific for AmpC and OprD were generated by GenScript. The epitopes for each are listed in Supplemental file 2 ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Biochemistry 2023Quote: ... coli cells by Genscript (Piscataway, NJ) and subcloned into the in-house pETCH vector ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain BL21 (DE3) cells and purified by Ni-NTA chromatography (GenScript).
-
bioRxiv - Biochemistry 2023Quote: ... 150 μL of 100% Anti-DYKDDDDK G1 affinity resin (GenScript) was prewashed with cold PBS (3 x ...
-
bioRxiv - Biochemistry 2023Quote: ... coli was obtained in pET22b vector from Genscript. LceB without the secretion signal was PCR amplified off the plasmid to include restriction sites NdeI and BamHI ...
-
bioRxiv - Biochemistry 2023Quote: ... a rabbit anti-Strep-tag IgG antibody (Genscript, Piscataway, NJ, USA) and a goat anti-rabbit IgG Alexa 488 conjugate as secondary antibody were used ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Cell Biology 2023Quote: To generate UAS-MIM-Emerald – MIM-Emerald cDNA was synthetized (Genscript). The sequence of MIM Isoform C (longest transcript ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Genetics 2023Quote: ... All gene synthesis was completed by Genscript (Piscataway, NJ).
-
bioRxiv - Bioengineering 2023Quote: ... along with CH2-CH3 of the IgG1 constant region were inserted into the pCVL-SFFV-muScn-IRES-GFP mammalian expression plasmid (Genscript, Nanjing, Jiangsu, China). Protein was expressed utilizing the Daedalus system with a C-terminal LPETG - 6x His tag.46 Proteins were purified and stored in PBS for later use.
-
bioRxiv - Bioengineering 2023Quote: ... was purchased from GenScript (Nanjing, China).
-
bioRxiv - Cancer Biology 2023Quote: ... Knockout of β2m was performed using the pLentiCRISPR v2 CRISPR/Cas9 system37 using a pLentiCRISPR v2 plasmid encoding the β2m-targeting guide RNA (gRNA): GAGTAGCGCGAGCACAGCTA (Genscript). Lentiviral particles were packaged in HEK293T cells (ATCC ...
-
bioRxiv - Biophysics 2023Quote: ... were used as described previously.22 These substrates were custom synthesised by GenScript, NJ ...
-
bioRxiv - Cell Biology 2023Quote: Complete or partial sequences of RAB13 were chemically synthesized using an artificial gene synthesis service (GenScript) and inserted into either the pcDNA3.1+ or pcDNA3.1_N-eGFP vectors using the In-Fusion HD Cloning Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the uricase-like coding sequence (XM_015290876.2) of LOC101747367 was synthesized by Genscript (USA Inc.) into pcDNA3.1+/ C-(K)DYK standard vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript, anti-HA from Roche, anti-V5 from Genscript, HRP-linked ECL rabbit-IgG and mouse-IgG from Amersham ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript, anti-HA from Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... BsmbI and NotI sites for bccyb5 (UniProt identifier A0A384K1M2) and bccbr1 (UniProt identifier A0A384JNH0) were codon-optimised for yeast and provided by Genscript Biotech Corp ...
-
bioRxiv - Biophysics 2023Quote: ... All conditions were ran on the 12% SDS-PAGE gel (SurePAGE™/Bis-Tris, M00668, GenScript) and the molecular weights were approximated using SeeBlue™ Plus2 Pre-stained Protein Standard (LC5925 ...
-
bioRxiv - Biophysics 2023Quote: A Gly-Gly-Gly-Cys peptide with C-terminal amidation (Genscript) was dissolved at 173 mM in degassed coupling buffer (50 mM HEPES (pH 7.4) ...
-
bioRxiv - Bioengineering 2023Quote: ... The oligonucleotide library was synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Biophysics 2023Quote: The Nmar_0206 gene was obtained from Genscript BioTech with a N-terminal histidine tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... The SGRP AA sequence was codon-optimized using GenSmart Codon Optimization (GenScript Biotech, USA) with ‘Human T-cell’ set as the expression host organism ...
-
bioRxiv - Cancer Biology 2023Quote: ... pEGFPN1-Casp2D135A mutant constructs were generated by GenScript. H1299p53R273H-CASP2-/- cells were seeded at 2 x 105/well in 6-well plates one day before transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Cancer Biology 2023Quote: Point directed mutagenesis was performed in BirA*-Casp2 to generate BirA*-Casp2C320G mutant by GenScript (Piscataway, New Jersey, USA). H1299p53R273H-Casp2-/- cells were seeded at 1.5 x 106 cells in 10cm dishes one day before transfection ...