Labshake search
Citations for GenScript :
1401 - 1450 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... which contains an N-terminal pelB signal sequence and hexahistidine tag (Genscript). The construct was transformed into chemically competent C41 (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of small-BiT was fused to the gene of peptide binders and the coding sequence of large-BiT was fused to the coding sequence of the target peptide (Genscript). The BiT-fused proteins and peptides were expressed and purified with the same protocol for RBLs ...
-
bioRxiv - Biochemistry 2023Quote: ... coli and purified using Ni-NTA chromatography (Genscript). AiEvo2 protein was complexed with guide RNA (IDT ...
-
bioRxiv - Cancer Biology 2023Quote: Point directed mutagenesis was performed in BirA*-Casp2 to generate BirA*-Casp2C320G mutant by GenScript (Piscataway, New Jersey, USA). H1299p53R273H-Casp2-/- cells were seeded at 1.5 x 106 cells in 10cm dishes one day before transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PAR sensor cell line was generated by cloning the APLF cDNA sequence (Genscript) into the pHR-FUSN-mCh-CRY2WT plasmid (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: Complete or partial sequences of RAB13 were chemically synthesized using an artificial gene synthesis service (GenScript) and inserted into either the pcDNA3.1+ or pcDNA3.1_N-eGFP vectors using the In-Fusion HD Cloning Kit (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript, anti-HA from Roche, anti-V5 from Genscript, HRP-linked ECL rabbit-IgG and mouse-IgG from Amersham ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript, anti-HA from Roche ...
-
bioRxiv - Cell Biology 2023Quote: To generate UAS-MIM-Emerald – MIM-Emerald cDNA was synthetized (Genscript). The sequence of MIM Isoform C (longest transcript ...
-
bioRxiv - Bioengineering 2023Quote: ... A pET29b expression plasmid encoding I53-50B.4PT1 16 was synthesized by GenScript using the NdeI and XhoI restriction sites with a double stop codon just before the C-terminal polyhistidine tag ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... BsmbI and NotI sites for bccyb5 (UniProt identifier A0A384K1M2) and bccbr1 (UniProt identifier A0A384JNH0) were codon-optimised for yeast and provided by Genscript Biotech Corp ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the uricase-like coding sequence (XM_015290876.2) of LOC101747367 was synthesized by Genscript (USA Inc.) into pcDNA3.1+/ C-(K)DYK standard vector ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Bioengineering 2023Quote: ... the aqueous phase consisted of 10 kDa 8-arm PEG-vinyl sulfone (PEG-VS) (JenKem, Plano, TX) and RGD (Ac-RGDSPGERCG-NH2, Genscript, Piscataway, NJ) in 100 mM HEPES buffer (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid ...
-
bioRxiv - Biophysics 2023Quote: ... All conditions were ran on the 12% SDS-PAGE gel (SurePAGE™/Bis-Tris, M00668, GenScript) and the molecular weights were approximated using SeeBlue™ Plus2 Pre-stained Protein Standard (LC5925 ...
-
bioRxiv - Biophysics 2023Quote: A Gly-Gly-Gly-Cys peptide with C-terminal amidation (Genscript) was dissolved at 173 mM in degassed coupling buffer (50 mM HEPES (pH 7.4) ...
-
bioRxiv - Bioengineering 2023Quote: ... The oligonucleotide library was synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Cancer Biology 2023Quote: ... Knockout of β2m was performed using the pLentiCRISPR v2 CRISPR/Cas9 system37 using a pLentiCRISPR v2 plasmid encoding the β2m-targeting guide RNA (gRNA): GAGTAGCGCGAGCACAGCTA (Genscript). Lentiviral particles were packaged in HEK293T cells (ATCC ...
-
bioRxiv - Biophysics 2023Quote: ... were used as described previously.22 These substrates were custom synthesised by GenScript, NJ ...
-
bioRxiv - Biophysics 2023Quote: The Nmar_0206 gene was obtained from Genscript BioTech with a N-terminal histidine tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... The SGRP AA sequence was codon-optimized using GenSmart Codon Optimization (GenScript Biotech, USA) with ‘Human T-cell’ set as the expression host organism ...
-
bioRxiv - Cancer Biology 2023Quote: ... pEGFPN1-Casp2D135A mutant constructs were generated by GenScript. H1299p53R273H-CASP2-/- cells were seeded at 2 x 105/well in 6-well plates one day before transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Western blotting was performed as previously described (43) using SDS-PAGE gels (GenScript, #M41210) and transferred to 0.45um immune-blot PVDF membrane (Millipore ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.25% DMSO) (refer to Fig. 1C) in the presence or absence of SARS-CoV-2 spike protein (5ng/mL; GenScript). Controls were kept in the treatment solution with only DMSO ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of the 11 subunits of mouse CMG were codon optimised for high-level expression in budding yeast cells and produced by DNA synthesis (GenScript Biotech). A previously described ‘yeast toolkit’ (Lee et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... PreScission protease (GenScript, Piscataway, NJ) was added to cleave the His-tags ...
-
bioRxiv - Biochemistry 2023Quote: MCM genes were synthesised and cloned into the ampicillin resistant pONT vector by GenScript (Supplementary Table 1). Genes were positioned downstream of a T7 promoter and N-terminally His-10 tagged ...
-
bioRxiv - Biochemistry 2023Quote: Codon-optimized MojV (Genbank NC 025352.1) F and G open reading frames (ORFs) were synthesized by GenScript® (Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: ... coli by GenScript. These genes were prefixed with HRV 3C cleavage sites and cloned into the corresponding vectors between the NdeI and XhoI sites ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Biochemistry 2023Quote: The R36S mutant His-tagged HGD gene (CRYGD) subcloned into Nde1 and BamH1 sites of pET-30b(+) was purchased from Genscript. The plasmid was transformed into E ...
-
bioRxiv - Biochemistry 2023Quote: ... The successful removal of His-tag was validated by western blot using the anti-His-tag antibody (Genscript, A00186-100).
-
bioRxiv - Biochemistry 2023Quote: ... by Genscript. The C121S ΔPTPN1 mutant was generated from the ΔPTPN1 vector using a QuikChange II Site Directed Mutagenesis kit (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... These peptides were synthesized by GenScript and provided as lyophilized powder before being resuspended in milliQ water at a final concentration of 2 mg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... pcDNA3.1-NR2F1-DYK (Genscript clone ID: OHu23866D), was used as the template for the site-directed mutagenesis (Liu & Naismith ...
-
bioRxiv - Biochemistry 2023Quote: ... or with p416-GPD-PfNF54_070015200 (hereafter referred to as p416-PfPolK, i.e., cloned with the Plasmodium PfPolK gene optimized by Genscript for expression in yeast). Yeast expression vectors were transformed into yeasts by the lithium acetate method (Gietz & Woods ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CsoS2-N (1:10,000 dilution; synthesized by GenScript, NJ ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids pMC1249 and pMC1250 were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Neuroscience 2023Quote: ... Purified monomer protein was subjected to two to three rounds of endotoxin removal (Endotoxin removal kit, GenScript) until a level of <0.1 EU per mg was achieved ...
-
bioRxiv - Neuroscience 2023Quote: ... Endotoxin levels were determined using a LAL chromogenic endotoxin quantification kit (GenScript).
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Microbiology 2023Quote: ... The hygromycin resistance gene was amplified from the pLew90 vector [60] (primers p39/p40) and puromycin resistance gene from a codon-optimized puromycin gene in a vector synthesized by GenScript as previously described (primers p41/p42 ...
-
bioRxiv - Microbiology 2023Quote: The nanS gene sequence was synthesized by GenScript and inserted into a pET-47b(+ ...