Labshake search
Citations for GenScript :
901 - 950 of 973 citations for Dengue Virus Serotype 2 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Cell adhesion was enabled in all hydrogel groups through incorporation of either 1 mM RGD peptide (GCGYGRGDSPG, Genscript) or 2 μM thiolated Fn fragments (Fn9*10 or Fn4G) ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Biophysics 2020Quote: The mouse 5-HT3AR (NCBI Reference Sequence: NM_001099644.1) gene was codon-optimized for Spodoptera frugiperda (Sf9) cells and purchased from GenScript. The construct consists of the 5-HT3AR gene along with a C-terminal 1D4-tag42 and four strep-tags (WSHPQFEK ...
-
bioRxiv - Immunology 2022Quote: ... The cells were allowed to adhere for 24 hours prior to treatment with mouse IL11 (UniProtKB: P47873, GenScript) or mouse TGFβ1 (R&D Systems ...
-
bioRxiv - Immunology 2023Quote: ... the transduction rate of lentivirus on Car-T cells was analyzed by FITC-anti-VHH antibody (GenScript Inc.). Target cells were detected for NKG2D ligands using anti-MICA/MICB and anti-ULBP2/5/6 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were subsequently washed with PBS and stained with α-camelid VHH antibodies (1:100, clone 96A3F5, Genscript) in 200 µl Cell Staining buffer for 30 min at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then pulsed with 20μg/ml OVA323–339 peptide (GenScript, Piscataway, NJ, Cat. No. RP10610-1) for 2 hours at 37℃ and 5% CO2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Enzymatically (metalloproteinase (MMP)) degradable di-thiolated peptides (GCNSVPMSMRGGSNCG) and thiolated cell-adhesive RGD peptides (GCGYGRGDSPG) were purchased from Genscript. NorHA hydrogels were fabricated by thiol-ene addition crosslinking with either ultraviolet (microwells ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant human ACE2-ECD fused with Flag/His tag was produced in 293T cells and purified with anti-DYKDDDDK G1 Affinity Resin according to the manufacturer’s instructions (GenScript).
-
bioRxiv - Immunology 2022Quote: ... total splenocytes were seeded at 0.5×106 cells per well in a 24-well plate and stimulated with 0.1 μM OVA257-264 (Genscript RP10611) peptide and 20 ng/ml recombinant murine interleukin-2 (IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... ANS4-GFP and bEnd.3 cells were both treated with 100nM of 43gap 26 peptide (VCYDKSFPISHVR) (Genscript, catalogue # RP20274), every 8 hr for 24 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... CB6 (heavy chain GenBank MT470197, light chain GenBank MT470196) was custom produced in a mammalian cell system by Genscript.
-
bioRxiv - Biophysics 2020Quote: ... or a SARS-CoV (amino acid residues 1 to 1193) (GenBank: AAS00003.1) were synthesized using -optimized codons for Cricetulus griseus (CHO Cell) by GenScript. The cDNAs were subcloned into pTRIMER expression vector (GenHunter ...
-
bioRxiv - Immunology 2022Quote: ... KIR2DL3 stable HEK293F cell lines were established to evaluate the molecules recognizing the KIR receptors using pcDNA3.1 vectors (OHu24667C, OHu17046C, OHu55562C) (GenScript). The live cells were stained for NK and CD8+ T cell surface markers (anti-CD3 ...
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: DNA sequences used for plasmid construction were either amplified from the cDNA of HEK293T cells or purchased from GenScript and WZ Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Cell Biology 2024Quote: ... Validated CRISPR/Cas9 gene-edited HeLa knock-out cells (FCHSD2-/- and MICAL-L1-/-) were obtained from GenScript (Piscataway, NJ). All media also contained 100 μg/ml Normocin (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... to reflect the reducing conditions in the cytoplasm of the cell) and AQP4ct (Ac-256VEFKRRFKEAFSKAAQQTKG SYMEV280-NH2) peptides were synthesized by Genscript Inc ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid directing expression of mouse ARL16-myc in mammalian cells was obtained by first having the open reading frame synthesized by GenScript and later using PCR to amplify this open reading frame with insertion of the C-terminal myc epitope (EQKLISEEDL ...
-
bioRxiv - Biochemistry 2021Quote: ... sequences with codons optimized for expression in human cells were synthesized and cloned into pHLSec between AgeI/KpnI by Genscript. The constructs were co-transfected with Furin-encoding plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... NS3/4A expression vector was generated by subcloning a synthetic gene which was codon optimized for expression in human cells (Genscript) into the pCI plasmid ...
-
bioRxiv - Biochemistry 2022Quote: Heavy and light chain sequences of CS-17 were determined from sequencing of CS-17 murine hybridoma cell line PTA-8174 (ATCC) by Genscript. The resulting sequences were cloned into a pCDNA3.4-containing murine IgG2a construct ...
-
bioRxiv - Biochemistry 2020Quote: ... Yields of the cell-penetrating peptide were determined by comparing tryptophan absorbance at 280 nm to that of a peptide standard (Genscript). This peptide product was verified by time-of-flight electrospray ionization cationic mass spectroscopy Agilent QTOF 6540) ...
-
bioRxiv - Immunology 2020Quote: ... BMDCs (105 cells) were incubated overnight in the presence of 10 μg/ml of influenza HA518–526 (IYSTVASSL) peptide (Genscript). IMALs were isolated from treated mice and A205804 was added to the plate for 5 d ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Neuroscience 2019Quote: ... The following reagents or cell lines were used in this study: a human Aβ42 peptide (GenScript, Nanjing, China, cat# RP10017), the Dicer1 siRNA duplex and the negative control (NC ...
-
bioRxiv - Immunology 2021Quote: ... The full-length S-genes were codon optimized for expression in Spodoptera frugiperda (Sf9) cells and synthetically produced by GenScript® service (GenScript USA ...
-
bioRxiv - Immunology 2020Quote: ... Genes for expression of HA fusions to nanoparticle trimeric components were codon optimized for expression in human cells and cloned into the CMV/R (VRC 8400) mammalian expression vector by Genscript. All HA fusions to the I53_dn5B trimer contained full-length HA ectodomains including native secretion signals ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 ml of supernatant (conditioned media) were collected for each clone and cells were frozen down to avoid clone loss (GenScript). The conditioned media of all 10 positive clones were analyzed in-house by WB against 200 ng of purified protein/lane using a 1:10 dilution as described ...
-
bioRxiv - Biochemistry 2021Quote: The Chinese Hamster Ovary-glutamine synthetase (CHO-GS) engineered cell line for production of Trastuzumab was kindly provided by GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Immunology 2020Quote: ... Peptide-specific T cell lines were grown similarly using autologous irradiated BLCLs pulsed with 15-mers A3C-1 and A3C-B (GenScript).
-
bioRxiv - Microbiology 2022Quote: ... flanked with Sal I & Not I was codon-optimized using the UpGene algorithm for optimal expression in mammalian cells [52] and synthesized (GenScript). The construct also contained a Kozak sequence (GCCACC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This gene was codon optimized for human cell expression and made in the CMV/R mammalian expression vector by Genscript. Transient transfection into HEK293F cells was carried out using PEI MAX ...
-
bioRxiv - Immunology 2022Quote: ... The S gene was codon optimized for high level expression in CHO mammalian cells and biochemically synthesized by Genscript (China). Compared to the reference gene ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Microbiology 2024Quote: ... placed into the sample cell and titrated with 3.2–4.8 μl aliquots of 0.1–1 mM peptide solutions (purchased from GenScript, Piscataway, NJ, USA), 2 mM SAM or 250 µM SAH ...
-
bioRxiv - Cell Biology 2024Quote: ... Di-thiolated peptides that are susceptible to metalloproteinase (MMP) cleavage (GCNSVPMSMRGGSNCG) and thiolated cell-adhesive peptides (GCGYGRGDSPG) were obtained from Genscript. HA hydrogels were fabricated by mixing 4 wt% norbornene-modified HA with 0.05 wt% photo-initiator lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Cell Biology 2024Quote: The human K6a sequence flanked by an amino-terminal HA tag and a carboxyl-terminal Flag tag (HA-hK6a-FLAG) was generated by PCR using pUC57-hK6a as a template which is codon-optimized for mammalian cell expression (Genscript). The sequence was inserted into lentiviral expression vector pCDH533-IRES-Neo (System Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Bioengineering 2023Quote: ... The cells bearing different constructs were labeled with anti-FLAG-iFluor 488 and anti-HPC4-iFluor 647 antibodies (GenScript, China) followed by detection using similar protocols published previously(21 ...
-
bioRxiv - Microbiology 2023Quote: ... XG014 and DXP-604 were produced by transfection of HD CHO-S cells with plasmids in a 30-ml volume (GenScript). Monoclonal IgA1 antibodies were produced in CHO cells transiently transfected with two plasmids expressing a heavy and light chain ...
-
bioRxiv - Immunology 2023Quote: ... flanked with Sal I & Not I was codon-optimized using the UpGene algorithm for optimal expression in mammalian cells (68) and synthesized (GenScript). The construct also contained a Kozak sequence (GCCACC ...