Labshake search
Citations for GenScript :
601 - 650 of 915 citations for Dengue Virus Serotype 2 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Substrate phosphorylation time course assays with PKD1ULD-5G/10G-KD were performed on ice with 50 nM protein and 100 µM biotinylated Syntide2 (biotin-PLARTSVAG (GenScript)) ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Biochemistry 2021Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal decahistidine (10X His) tagged fusion protein (GenScript) (Fig ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2020Quote: ... 1mL of day 56 serum was diluted to 10 mL with PBS and incubated with 1 mL of 3x PBS washed protein A beads (GenScript) with agitation overnight at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... the protein sequence was analyzed for multiple features such as antigenicity and hydrophobicity by the antibody manufacturer (GenScript, Piscataway, NJ), using the OptimumAntigen™ Design Tool (https://www.genscript.com/antigen-design.html) ...
-
bioRxiv - Immunology 2021Quote: ... for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS ...
-
bioRxiv - Immunology 2021Quote: ... cDNAs for these proteins and the mutated versions of Cda2 (Cda2-M1 and Cda2-M2) were synthesized and cloned in pET19b (GenScript) so that the vector-encoded His tag was integrated with the N-terminus of the cDNA ...
-
bioRxiv - Immunology 2021Quote: ... This recombinant target panel consisted of two full-length viral structural proteins, S (FL, trimer-stabilized, LakePharma) and N (GenScript); two truncated S protein domains ...
-
bioRxiv - Microbiology 2020Quote: ... the fixed cells were labeled with primary antibodies including goat anti-major outer-membrane protein (MOMP; Meridian, Memphis, TN) and mouse or rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Microbiology 2023Quote: ... The number and size of cleavage products were assessed by visualization of protein bands on 8-16% SurePAGE precast gels (GenScript) using MES SDS running buffer (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Plant Biology 2023Quote: ... Colonies exhibiting VENUS fluorescence and an AphVII cassette knock-in at the CAS9 target site were examined for accumulation of the CreTPT3 protein by immunodetection using CreTPT3 antibodies generated by GenScript USA Inc (Piscataway ...
-
bioRxiv - Immunology 2023Quote: ... backbone and cDNA sequences for human NINJ1 (UniProtKB Q92982) or NINJ2 (UniProtKB Q9NZG7) protein with an N-terminal 3xFLAG tag and GSG linker were ordered from Genscript. For protein expression ...
-
bioRxiv - Molecular Biology 2023Quote: The DNA sequences of all smORF proteins were synthesized and subcloned into a modified pRSET vector by GenScript (Hong Kong). The construct was tailored to have an N-terminal hexa-histidine-tagged lipoyl fusion protein followed by a thrombin cleavage site and the respective smORF protein ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... The gene encoding the phage CARD-only protein (pCARD) from Acinetobacter phage 133 (IMG gene accession 651703305) was synthesized and cloned by Genscript Corp ...
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were washed with TAP-wash buffer and proteins were eluted using HA peptide (200 μg/ml; GenScript, RP11735) by shaking the beads in thermomixer at 1400 rpm for 45 min at 30 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 20-30ug of total protein per sample was loaded into wells of 4-12% Bis-Tris gels (Genscript or Invitrogen) and separated in MES or MOPS buffer ran at 65v for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Neuroscience 2023Quote: ... stephanieae’s transcriptome for the bioactive ELH peptide was translated into a predicted protein and synthesized by Genscript (Piscataway, NJ, USA) to 95 % purity ...
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Biochemistry 2023Quote: ... coli cells by Genscript (Piscataway, NJ) and subcloned into the in-house pETCH vector ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Pathology 2019Quote: ... The samples were loaded onto a 12% (vol/vol) SDS/PAGE gel and target proteins were detected using a polyclonal anti-GFP antibody (GenScript, USA) or a monoclonal anti-FLAG (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... FLAG-tagged proteins were released from the resin by incubation with buffer supplemented with 50 mM FLAG peptide (Genscript, Piscataway, NJ) for 30 min.
-
The E3 ubiquitin-protein ligase MDM2 is a novel interactor of the von Hippel-Lindau tumor suppressorbioRxiv - Biochemistry 2020Quote: ... Genes encoding the human MDM2 and pVHL30 proteins were obtained from commercial plasmid provided by GenScript (GenEZ plasmid OHu28568 and OHu23297) and cDNA transferred into pGBKT7 and pGADT7 plasmids (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs that code mature proteins of human mitochondrial ECSIT (UniProtKB-Q9BQ95) and NDUFAF1 (UniProtKB-Q9Y375) were purchased from GenScript (Piscataway, USA) as codon-optimized for E ...
-
bioRxiv - Biophysics 2020Quote: ... The identities of purified HA-TIN2S and HA-TIN2L proteins were confirmed by the Western Blot analysis using the HA antibody (GenScript A00168), and MALDI-TOF mass spectrometry analysis (UNC-Chapel Hill Proteomics Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Sequences encoding the 3CL-pro and RBD proteins were codon optimized for expression in Escherichia coli and cloned into the pET-28a(+) vector (Genscript Biotech). The chimeric protein 3CLpro-RBD was produced by generating a gene construct that linked the 3CL-pro and RBD genes by a bridge sequence that encoded for glycine-proline triple repeat (GPGPGP ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...