Labshake search
Citations for GenScript :
401 - 450 of 915 citations for Dengue Virus Serotype 2 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Biochemistry 2019Quote: ... The gene encoding NB4 mutant 2 (L13S, Q15D, K45D, K66D) was synthesised (GenScript), amplified and cloned into the pHEN6c expression vector ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 minutes followed by 20 μM biotinylated FLAG-tag antibody (A01429, GenScript) for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into pCEP4 mammalian expression vector with a N-terminal IgG leader sequence and C-terminal Avitag and His tag ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid encoding for SARS-CoV-2 S RBD was synthesized commercially (Genscript). The RBD sequence (encoding for residues 319-541 ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2021Quote: ... codon-optimized SARS-CoV-2 ORF3 and E genes were synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 spike glycoprotein expression constructs were synthesized by GenScript (Netherlands). Constructs bore the following mutations relative to the Wuhan-Hu-1 sequence (GenBank ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339, GenScript) was added ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Molecular Biology 2022Quote: The sequence for Rab7A (residues 2-176, uniprot P51149) was purchased from Genscript, N-terminally fused to a His tag and tobacco etch virus (TEV ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Biophysics 2023Quote: ... The expression clone of ppSUMO-2_SARS-CoV-2 NSP16 was obtained from Genscript. Expression was carried out in E ...
-
bioRxiv - Immunology 2022Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into the pCEP4 mammalian expression vector (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: Full-length SARS-CoV-2 S gene (GenBank: NC_045512.2) was synthesized by Genscript. as human codon-optimized cDNAs ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Microbiology 2019Quote: ... The blot was washed and secondary antibody (for Ryp proteins: Goat α-rabbit HRP (GenScript) 1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... 50 µM of LPETG-His tagged protein was incubated with 1 mM GGG-azide (Genscript) and 25 µM His-tagged sortase-A7+ (recombinantly expressed in E ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.